EMAIL THIS PAGE TO A FRIEND

LIPE

lipase, hormone-sensitive

87 Gene Product Result for
Synonyms: HSL LHS
UniProtKB ID: Q05469, Q3LRT2, Q6NSL7
Gene ID:
Human(3991) Summary: The protein encoded by this gene has a long and a short form, generated by use of alternative translational start codons. The long form is expressed in steroidogenic tissues such as testis, where it converts cholesteryl esters to free cholesterol for steroid hormone production. The short form is expressed in adipose tissue, among others, where it hydrolyzes stored triglycerides to free fatty acids. [provided by RefSeq, Jul 2008]
Mouse(16890) lipase, hormone sensitive
Rat(25330) lipase, hormone sensitive
cow(286879) lipase, hormone-sensitive
domestic cat(751818) lipase, hormone-sensitive
dog(403607) lipase, hormone-sensitive
domestic guinea pig(100734974) lipase, hormone-sensitive
naked mole-rat(101709284) lipase, hormone-sensitive
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501762 Anti-HSL antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4501763 Anti-HSL antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1100202 Anti-LIPE (281-295) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100203 Anti-LIPE (921-935) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
PRS3965 Anti-Lipe antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2900275 Anti-LIPE antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
immunohistochemistry, western blot pricing
HPA006567 Anti-LIPE antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4503879 Anti-phospho-HSL (pSer552) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301506 Anti-phospho-HSL (pSer552) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB4503821 Anti-phospho-HSL (pSer855/554) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010719 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010719 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010719 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005357 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005357 Rosetta Predictions human pricing
NM_012859 Rosetta Predictions rat pricing
NM_001039507 Rosetta Predictions mouse pricing
NM_010719 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339446 predicted 561
2 SASI_Hs01_00175625 predicted 1043
3 SASI_Hs01_00175626 predicted 1145
4 SASI_Hs02_00339447 predicted 1920
5 SASI_Hs02_00339448 predicted 973
6 SASI_Hs01_00175629 predicted 1860
7 SASI_Hs01_00175630 predicted 1916
8 SASI_Hs01_00175631 predicted 1220
9 SASI_Hs01_00175632 predicted 908
10 SASI_Hs01_00175633 predicted 650
11 SASI_Hs01_00175624 predicted 965
12 SASI_Hs01_00175627 predicted 1656
13 SASI_Hs01_00175628 predicted 1648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012859 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069177 predicted 2127
2 SASI_Rn01_00069178 predicted 2308
3 SASI_Rn01_00069180 predicted 1135
4 SASI_Rn01_00069181 predicted 1066
5 SASI_Rn02_00260344 predicted 2857
6 SASI_Rn01_00069182 predicted 2316
7 SASI_Rn02_00260345 predicted 1558
8 SASI_Rn01_00069184 predicted 852
9 SASI_Rn01_00069185 predicted 1070
10 SASI_Rn01_00069186 predicted 646
11 SASI_Rn01_00069179 predicted 469
12 SASI_Rn01_00069183 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039507 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125779 predicted 506
2 SASI_Mm01_00125780 predicted 1491
3 SASI_Mm01_00125781 predicted 476
4 SASI_Mm01_00125782 predicted 1589
5 SASI_Mm01_00125784 predicted 1013
6 SASI_Mm01_00125785 predicted 1797
7 SASI_Mm01_00125786 predicted 1180
8 SASI_Mm01_00125787 predicted 1179
9 SASI_Mm01_00125788 predicted 523
10 SASI_Mm02_00290093 predicted 523
11 SASI_Mm01_00125783 predicted 1116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090382 predicted 950
2 SASI_Mm01_00090383 predicted 1937
3 SASI_Mm01_00090384 predicted 923
4 SASI_Mm01_00090385 predicted 2031
5 SASI_Mm01_00090387 predicted 1450
6 SASI_Mm01_00090388 predicted 2235
7 SASI_Mm01_00090389 predicted 1627
8 SASI_Mm01_00090390 predicted 1622
9 SASI_Mm01_00090391 predicted 960
10 SASI_Mm02_00319193 predicted 968
11 SASI_Mm01_00090386 predicted 1561
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010719
LIPE MISSION shRNA Bacterial Glycerol Stock
lipase, hormone-sensitive
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010719.5-1739s21c1
Sequence:CCGGGTTCAACTGGAGAGCGGATATCTCGAGATATCCGCTCTCCAGTTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010719.2-2088s1c1
Sequence:CCGGGCTAGATGACTCGGTCATGTTCTCGAGAACATGACCGAGTCATCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010719.2-1122s1c1
Sequence:CCGGCCCTATCTTCTCCATCGACTACTCGAGTAGTCGATGGAGAAGATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010719.2-39s1c1
Sequence:CCGGCGCAGAAGACAATATGGCCTTCTCGAGAAGGCCATATTGTCTTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010719.2-682s1c1
Sequence:CCGGCGCATCATACAGAACCTGGATCTCGAGATCCAGGTTCTGTATGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010719.2-255s1c1
Sequence:CCGGCCTACTACACAAATCCCGCTACTCGAGTAGCGGGATTTGTGTAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010719.5-869s21c1
Sequence:CCGGTCCGTGCTATGGCCTACTATGCTCGAGCATAGTAGGCCATAGCACGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010719
LIPE MISSION shRNA shRNA Plasmid DNA
lipase, hormone-sensitive
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010719.5-1739s21c1
Sequence:CCGGGTTCAACTGGAGAGCGGATATCTCGAGATATCCGCTCTCCAGTTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010719.2-2088s1c1
Sequence:CCGGGCTAGATGACTCGGTCATGTTCTCGAGAACATGACCGAGTCATCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010719.2-1122s1c1
Sequence:CCGGCCCTATCTTCTCCATCGACTACTCGAGTAGTCGATGGAGAAGATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010719.2-39s1c1
Sequence:CCGGCGCAGAAGACAATATGGCCTTCTCGAGAAGGCCATATTGTCTTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010719.2-682s1c1
Sequence:CCGGCGCATCATACAGAACCTGGATCTCGAGATCCAGGTTCTGTATGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010719.2-255s1c1
Sequence:CCGGCCTACTACACAAATCCCGCTACTCGAGTAGCGGGATTTGTGTAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010719.5-869s21c1
Sequence:CCGGTCCGTGCTATGGCCTACTATGCTCGAGCATAGTAGGCCATAGCACGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010719
LIPE MISSION shRNA Lentiviral Transduction Particles
lipase, hormone-sensitive
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010719.5-1739s21c1
Sequence:CCGGGTTCAACTGGAGAGCGGATATCTCGAGATATCCGCTCTCCAGTTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010719.2-2088s1c1
Sequence:CCGGGCTAGATGACTCGGTCATGTTCTCGAGAACATGACCGAGTCATCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010719.2-1122s1c1
Sequence:CCGGCCCTATCTTCTCCATCGACTACTCGAGTAGTCGATGGAGAAGATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010719.2-39s1c1
Sequence:CCGGCGCAGAAGACAATATGGCCTTCTCGAGAAGGCCATATTGTCTTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010719.2-682s1c1
Sequence:CCGGCGCATCATACAGAACCTGGATCTCGAGATCCAGGTTCTGTATGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010719.2-255s1c1
Sequence:CCGGCCTACTACACAAATCCCGCTACTCGAGTAGCGGGATTTGTGTAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010719.5-869s21c1
Sequence:CCGGTCCGTGCTATGGCCTACTATGCTCGAGCATAGTAGGCCATAGCACGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005357
LIPE MISSION shRNA Bacterial Glycerol Stock
lipase, hormone-sensitive
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005357.2-2993s1c1
Sequence:CCGGCCCTCCGATGTCAACTTCTTACTCGAGTAAGAAGTTGACATCGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005357.2-662s1c1
Sequence:CCGGCCAGCATTGAGACAAAGACATCTCGAGATGTCTTTGTCTCAATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005357.2-818s1c1
Sequence:CCGGCCTGAACAGTCAGACAAGCAACTCGAGTTGCTTGTCTGACTGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005357.2-2770s1c1
Sequence:CCGGCCTGGAGTTAAGTGGGCGCAACTCGAGTTGCGCCCACTTAACTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005357.2-978s1c1
Sequence:CCGGCAGAATCAGATGTGGGATCATCTCGAGATGATCCCACATCTGATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005357.2-1437s21c1
Sequence:CCGGTCCTGCACAAATCCCGCTATGCTCGAGCATAGCGGGATTTGTGCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005357.2-2129s21c1
Sequence:CCGGGAGCTCAGCAGCCTGATAAAGCTCGAGCTTTATCAGGCTGCTGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005357.2-2962s21c1
Sequence:CCGGGCTGTCAGCTGAGACACTTAGCTCGAGCTAAGTGTCTCAGCTGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005357.2-1656s21c1
Sequence:CCGGTGCATAAGGGATGCTTCTATGCTCGAGCATAGAAGCATCCCTTATGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005357.2-875s21c1
Sequence:CCGGTCTTTGACAGAGCTGGGATTTCTCGAGAAATCCCAGCTCTGTCAAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005357
LIPE MISSION shRNA shRNA Plasmid DNA
lipase, hormone-sensitive
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005357.2-2993s1c1
Sequence:CCGGCCCTCCGATGTCAACTTCTTACTCGAGTAAGAAGTTGACATCGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005357.2-662s1c1
Sequence:CCGGCCAGCATTGAGACAAAGACATCTCGAGATGTCTTTGTCTCAATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005357.2-818s1c1
Sequence:CCGGCCTGAACAGTCAGACAAGCAACTCGAGTTGCTTGTCTGACTGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005357.2-2770s1c1
Sequence:CCGGCCTGGAGTTAAGTGGGCGCAACTCGAGTTGCGCCCACTTAACTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005357.2-978s1c1
Sequence:CCGGCAGAATCAGATGTGGGATCATCTCGAGATGATCCCACATCTGATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005357.2-1437s21c1
Sequence:CCGGTCCTGCACAAATCCCGCTATGCTCGAGCATAGCGGGATTTGTGCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005357.2-2129s21c1
Sequence:CCGGGAGCTCAGCAGCCTGATAAAGCTCGAGCTTTATCAGGCTGCTGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005357.2-2962s21c1
Sequence:CCGGGCTGTCAGCTGAGACACTTAGCTCGAGCTAAGTGTCTCAGCTGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005357.2-1656s21c1
Sequence:CCGGTGCATAAGGGATGCTTCTATGCTCGAGCATAGAAGCATCCCTTATGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005357.2-875s21c1
Sequence:CCGGTCTTTGACAGAGCTGGGATTTCTCGAGAAATCCCAGCTCTGTCAAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005357
LIPE MISSION shRNA Lentiviral Transduction Particles
lipase, hormone-sensitive
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005357.2-2993s1c1
Sequence:CCGGCCCTCCGATGTCAACTTCTTACTCGAGTAAGAAGTTGACATCGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005357.2-662s1c1
Sequence:CCGGCCAGCATTGAGACAAAGACATCTCGAGATGTCTTTGTCTCAATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005357.2-818s1c1
Sequence:CCGGCCTGAACAGTCAGACAAGCAACTCGAGTTGCTTGTCTGACTGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005357.2-2770s1c1
Sequence:CCGGCCTGGAGTTAAGTGGGCGCAACTCGAGTTGCGCCCACTTAACTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005357.2-978s1c1
Sequence:CCGGCAGAATCAGATGTGGGATCATCTCGAGATGATCCCACATCTGATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005357.2-1437s21c1
Sequence:CCGGTCCTGCACAAATCCCGCTATGCTCGAGCATAGCGGGATTTGTGCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005357.2-2129s21c1
Sequence:CCGGGAGCTCAGCAGCCTGATAAAGCTCGAGCTTTATCAGGCTGCTGAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005357.2-2962s21c1
Sequence:CCGGGCTGTCAGCTGAGACACTTAGCTCGAGCTAAGTGTCTCAGCTGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005357.2-1656s21c1
Sequence:CCGGTGCATAAGGGATGCTTCTATGCTCGAGCATAGAAGCATCCCTTATGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005357.2-875s21c1
Sequence:CCGGTCTTTGACAGAGCTGGGATTTCTCGAGAAATCCCAGCTCTGTCAAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)