EMAIL THIS PAGE TO A FRIEND

LIPF

lipase, gastric

52 Gene Product Result for
Synonyms: GL HGL HLAL
UniProtKB ID: P07098, B7Z723, F5H1P4, Q2M1P6, Q5VXI7, Q5VXI8
Gene ID:
Human(8513) Summary: This gene encodes gastric lipase, an enzyme involved in the digestion of dietary triglycerides in the gastrointestinal tract, and responsible for 30% of fat digestion processes occurring in human. It is secreted by gastric chief cells in the fundic mucosa of the stomach, and it hydrolyzes the ester bonds of triglycerides under acidic pH conditions. The gene is a member of a conserved gene family of lipases that play distinct roles in neutral lipid metabolism. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Mouse(67717) lipase, gastric
Rat(50682) lipase, gastric
Zebrafish(406713) lipase, gastric
domestic cat(101092051) lipase, gastric
cow(281283) lipase, gastric
Horse(100062284) lipase, gastric
dog(403867) lipase, gastric
naked mole-rat(101702958) lipase, gastric
sheep(101122998) lipase, gastric
Domestic Rabbit(100338083) lipase, gastric
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004190 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004190 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004190 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026334 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026334 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026334 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059851 MISSION® esiRNA esiRNA human LIPF (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004190 Rosetta Predictions human pricing
NM_017341 Rosetta Predictions rat pricing
NM_026334 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095098 predicted 649
2 SASI_Hs01_00095099 predicted 615
3 SASI_Hs01_00095100 predicted 739
4 SASI_Hs01_00095101 predicted 450
5 SASI_Hs01_00095102 predicted 991
6 SASI_Hs01_00095103 predicted 787
7 SASI_Hs02_00337079 predicted 203
8 SASI_Hs01_00095104 predicted 549
9 SASI_Hs01_00095105 predicted 986
10 SASI_Hs01_00095107 predicted 328
11 SASI_Hs01_00095106 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017341 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119266 predicted 265
2 SASI_Rn01_00119267 predicted 641
3 SASI_Rn01_00119268 predicted 494
4 SASI_Rn01_00119269 predicted 398
5 SASI_Rn01_00119271 predicted 1061
6 SASI_Rn01_00119272 predicted 423
7 SASI_Rn01_00119273 predicted 981
8 SASI_Rn02_00261804 predicted 682
9 SASI_Rn01_00119274 predicted 537
10 SASI_Rn01_00119275 predicted 523
11 SASI_Rn01_00119270 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026334 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182157 predicted 594
2 SASI_Mm01_00182158 predicted 496
3 SASI_Mm01_00182159 predicted 403
4 SASI_Mm02_00330049 predicted 698
5 SASI_Mm01_00182160 predicted 277
6 SASI_Mm01_00182161 predicted 425
7 SASI_Mm01_00182162 predicted 271
8 SASI_Mm02_00330050 predicted 989
9 SASI_Mm01_00182163 predicted 640
10 SASI_Mm01_00182165 predicted 739
11 SASI_Mm01_00182164 predicted 473
12 SASI_Mm01_00182166 predicted 760
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004190
LIPF MISSION shRNA Bacterial Glycerol Stock
lipase, gastric
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004190.2-1042s21c1
Sequence:CCGGCCATTGGACCCAGGCTGTTAACTCGAGTTAACAGCCTGGGTCCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004190.1-495s1c1
Sequence:CCGGCCAGCCACAATCGACTTCATTCTCGAGAATGAAGTCGATTGTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004190.1-868s1c1
Sequence:CCGGTGGATGTGTATCTATCACATACTCGAGTATGTGATAGATACACATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004190.1-129s1c1
Sequence:CCGGCCTGAAGTGACTATGAACATTCTCGAGAATGTTCATAGTCACTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004190.1-741s1c1
Sequence:CCGGCCACACAACTTCTTTGATCAACTCGAGTTGATCAAAGAAGTTGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004190.1-415s1c1
Sequence:CCGGCCAGAAGAAACTTGTACTATTCTCGAGAATAGTACAAGTTTCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004190
LIPF MISSION shRNA shRNA Plasmid DNA
lipase, gastric
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004190.2-1042s21c1
Sequence:CCGGCCATTGGACCCAGGCTGTTAACTCGAGTTAACAGCCTGGGTCCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004190.1-495s1c1
Sequence:CCGGCCAGCCACAATCGACTTCATTCTCGAGAATGAAGTCGATTGTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004190.1-868s1c1
Sequence:CCGGTGGATGTGTATCTATCACATACTCGAGTATGTGATAGATACACATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004190.1-129s1c1
Sequence:CCGGCCTGAAGTGACTATGAACATTCTCGAGAATGTTCATAGTCACTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004190.1-741s1c1
Sequence:CCGGCCACACAACTTCTTTGATCAACTCGAGTTGATCAAAGAAGTTGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004190.1-415s1c1
Sequence:CCGGCCAGAAGAAACTTGTACTATTCTCGAGAATAGTACAAGTTTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004190
LIPF MISSION shRNA Lentiviral Transduction Particles
lipase, gastric
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004190.2-1042s21c1
Sequence:CCGGCCATTGGACCCAGGCTGTTAACTCGAGTTAACAGCCTGGGTCCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004190.1-495s1c1
Sequence:CCGGCCAGCCACAATCGACTTCATTCTCGAGAATGAAGTCGATTGTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004190.1-868s1c1
Sequence:CCGGTGGATGTGTATCTATCACATACTCGAGTATGTGATAGATACACATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004190.1-129s1c1
Sequence:CCGGCCTGAAGTGACTATGAACATTCTCGAGAATGTTCATAGTCACTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004190.1-741s1c1
Sequence:CCGGCCACACAACTTCTTTGATCAACTCGAGTTGATCAAAGAAGTTGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004190.1-415s1c1
Sequence:CCGGCCAGAAGAAACTTGTACTATTCTCGAGAATAGTACAAGTTTCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026334
LIPF MISSION shRNA Bacterial Glycerol Stock
lipase, gastric
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026334.1-749s1c1
Sequence:CCGGCCACAACTACTTAGATCAATTCTCGAGAATTGATCTAAGTAGTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026334.1-876s1c1
Sequence:CCGGGATGTGTATCTAGGGCATAATCTCGAGATTATGCCCTAGATACACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026334.1-329s1c1
Sequence:CCGGGATTACAAATCTGCCAAACAACTCGAGTTGTTTGGCAGATTTGTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026334.1-470s1c1
Sequence:CCGGCAGCTTTGATGAAATGGCTAACTCGAGTTAGCCATTTCATCAAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026334
LIPF MISSION shRNA shRNA Plasmid DNA
lipase, gastric
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026334.1-749s1c1
Sequence:CCGGCCACAACTACTTAGATCAATTCTCGAGAATTGATCTAAGTAGTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026334.1-876s1c1
Sequence:CCGGGATGTGTATCTAGGGCATAATCTCGAGATTATGCCCTAGATACACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026334.1-329s1c1
Sequence:CCGGGATTACAAATCTGCCAAACAACTCGAGTTGTTTGGCAGATTTGTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026334.1-470s1c1
Sequence:CCGGCAGCTTTGATGAAATGGCTAACTCGAGTTAGCCATTTCATCAAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026334
LIPF MISSION shRNA Lentiviral Transduction Particles
lipase, gastric
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026334.1-749s1c1
Sequence:CCGGCCACAACTACTTAGATCAATTCTCGAGAATTGATCTAAGTAGTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026334.1-876s1c1
Sequence:CCGGGATGTGTATCTAGGGCATAATCTCGAGATTATGCCCTAGATACACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026334.1-329s1c1
Sequence:CCGGGATTACAAATCTGCCAAACAACTCGAGTTGTTTGGCAGATTTGTAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026334.1-470s1c1
Sequence:CCGGCAGCTTTGATGAAATGGCTAACTCGAGTTAGCCATTTCATCAAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)