EMAIL THIS PAGE TO A FRIEND

LIPH

lipase, member H

120 Gene Product Result for
Synonyms: AH ARWH2 LAH2 LPDLR PLA1B mPA-PLA1
UniProtKB ID: Q8WWY8, A2IBA7, Q8TEC7
Gene ID:
Human(200879) Summary: This gene encodes a membrane-bound member of the mammalian triglyceride lipase family. It catalyzes the production of 2-acyl lysophosphatidic acid (LPA), which is a lipid mediator with diverse biological properties that include platelet aggregation, smooth muscle contraction, and stimulation of cell proliferation and motility. [provided by RefSeq, Jul 2008]
Mouse(239759) lipase, member H
Rat(681694) lipase, member H
chicken(424874) lipase, member H
dog(488112) lipase, member H
Horse(100067815) lipase, member H
cow(512028) lipase, member H
domestic cat(101092958) lipase, member H
naked mole-rat(101699015) lipase, member H
sheep(101116788) lipase, member H
Domestic Rabbit(100008812) lipase, member H
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139248 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139248 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139248 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153404 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153404 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153404 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139248 Rosetta Predictions human pricing
NM_001044279 Rosetta Predictions rat pricing
NM_001083894 Rosetta Predictions mouse pricing
NM_153404 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226899 predicted 1388
2 SASI_Hs01_00226900 predicted 1232
3 SASI_Hs01_00226901 predicted 1323
4 SASI_Hs01_00226902 predicted 755
5 SASI_Hs01_00226903 predicted 1301
6 SASI_Hs01_00226904 predicted 648
7 SASI_Hs01_00226905 predicted 1449
8 SASI_Hs01_00226906 predicted 1041
9 SASI_Hs01_00226907 predicted 712
10 SASI_Hs01_00226908 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205464 predicted 977
2 SASI_Rn02_00205465 predicted 549
3 SASI_Rn02_00205466 predicted 1252
4 SASI_Rn02_00205467 predicted 207
5 SASI_Rn02_00205468 predicted 1146
6 SASI_Rn02_00205469 predicted 678
7 SASI_Rn02_00205470 predicted 1283
8 SASI_Rn02_00205471 predicted 1239
9 SASI_Rn02_00205472 predicted 356
10 SASI_Rn02_00205473 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083894 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299871 predicted 1336
2 SASI_Mm02_00299872 predicted 452
3 SASI_Mm02_00299873 predicted 1230
4 SASI_Mm02_00299874 predicted 1186
5 SASI_Mm02_00299875 predicted 1479
6 SASI_Mm02_00299876 predicted 1238
7 SASI_Mm02_00299877 predicted 291
8 SASI_Mm02_00299878 predicted 1233
9 SASI_Mm02_00299879 predicted 1231
10 SASI_Mm02_00299880 predicted 1369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023142 predicted 1155
2 SASI_Mm01_00023143 predicted 364
3 SASI_Mm01_00023144 predicted 1048
4 SASI_Mm01_00023145 predicted 1010
5 SASI_Mm01_00023146 predicted 1298
6 SASI_Mm02_00343188 predicted 1051
7 SASI_Mm01_00023147 predicted 201
8 SASI_Mm02_00343189 predicted 1053
9 SASI_Mm01_00023149 predicted 1043
10 SASI_Mm01_00023150 predicted 1188
11 SASI_Mm01_00023148 predicted 682
12 SASI_Mm01_00023151 predicted 367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139248
LIPH MISSION shRNA Bacterial Glycerol Stock
lipase, member H
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139248.1-1571s1c1
Sequence:CCGGGCGTCCTATGGATGTCACATTCTCGAGAATGTGACATCCATAGGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139248.1-735s1c1
Sequence:CCGGGCCATTAGGAAACATAGACTTCTCGAGAAGTCTATGTTTCCTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139248.1-909s1c1
Sequence:CCGGCCAGGATTATAGGAATGGCAACTCGAGTTGCCATTCCTATAATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139248.1-559s1c1
Sequence:CCGGGCCCACATATCTGGGTTTGTTCTCGAGAACAAACCCAGATATGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139248.1-1324s1c1
Sequence:CCGGCGAATGAAGTTAAGGTCCCTTCTCGAGAAGGGACCTTAACTTCATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139248.2-1010s21c1
Sequence:CCGGTAATTGGAAAGACCATCTAAGCTCGAGCTTAGATGGTCTTTCCAATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139248.2-459s21c1
Sequence:CCGGTATACCCATGCCTCTAGTAAGCTCGAGCTTACTAGAGGCATGGGTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139248.2-210s21c1
Sequence:CCGGGTGGTTGGTACGGGACTAAATCTCGAGATTTAGTCCCGTACCAACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139248
LIPH MISSION shRNA shRNA Plasmid DNA
lipase, member H
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139248.1-1571s1c1
Sequence:CCGGGCGTCCTATGGATGTCACATTCTCGAGAATGTGACATCCATAGGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139248.1-735s1c1
Sequence:CCGGGCCATTAGGAAACATAGACTTCTCGAGAAGTCTATGTTTCCTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139248.1-909s1c1
Sequence:CCGGCCAGGATTATAGGAATGGCAACTCGAGTTGCCATTCCTATAATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139248.1-559s1c1
Sequence:CCGGGCCCACATATCTGGGTTTGTTCTCGAGAACAAACCCAGATATGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139248.1-1324s1c1
Sequence:CCGGCGAATGAAGTTAAGGTCCCTTCTCGAGAAGGGACCTTAACTTCATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139248.2-1010s21c1
Sequence:CCGGTAATTGGAAAGACCATCTAAGCTCGAGCTTAGATGGTCTTTCCAATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139248.2-459s21c1
Sequence:CCGGTATACCCATGCCTCTAGTAAGCTCGAGCTTACTAGAGGCATGGGTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139248.2-210s21c1
Sequence:CCGGGTGGTTGGTACGGGACTAAATCTCGAGATTTAGTCCCGTACCAACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139248
LIPH MISSION shRNA Lentiviral Transduction Particles
lipase, member H
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139248.1-1571s1c1
Sequence:CCGGGCGTCCTATGGATGTCACATTCTCGAGAATGTGACATCCATAGGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139248.1-735s1c1
Sequence:CCGGGCCATTAGGAAACATAGACTTCTCGAGAAGTCTATGTTTCCTAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139248.1-909s1c1
Sequence:CCGGCCAGGATTATAGGAATGGCAACTCGAGTTGCCATTCCTATAATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139248.1-559s1c1
Sequence:CCGGGCCCACATATCTGGGTTTGTTCTCGAGAACAAACCCAGATATGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139248.1-1324s1c1
Sequence:CCGGCGAATGAAGTTAAGGTCCCTTCTCGAGAAGGGACCTTAACTTCATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139248.2-1010s21c1
Sequence:CCGGTAATTGGAAAGACCATCTAAGCTCGAGCTTAGATGGTCTTTCCAATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139248.2-459s21c1
Sequence:CCGGTATACCCATGCCTCTAGTAAGCTCGAGCTTACTAGAGGCATGGGTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139248.2-210s21c1
Sequence:CCGGGTGGTTGGTACGGGACTAAATCTCGAGATTTAGTCCCGTACCAACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153404
LIPH MISSION shRNA Bacterial Glycerol Stock
lipase, member H
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153404.1-1593s1c1
Sequence:CCGGCCCTACAGCAAAGCACTTTGTCTCGAGACAAAGTGCTTTGCTGTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153404.2-1503s21c1
Sequence:CCGGTGTCAAAGGACCTGCGATTATCTCGAGATAATCGCAGGTCCTTTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153404.2-963s1c1
Sequence:CCGGGCCATACTGCATGTATCATTACTCGAGTAATGATACATGCAGTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153404.2-696s1c1
Sequence:CCGGCTCTGACACTGACGGTATAAACTCGAGTTTATACCGTCAGTGTCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153404.2-1013s1c1
Sequence:CCGGGCGTAAGAAGAGGGTTTATTACTCGAGTAATAAACCCTCTTCTTACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153404.2-1117s21c1
Sequence:CCGGGTGAGTCTCCTCGCAAGATTTCTCGAGAAATCTTGCGAGGAGACTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153404.2-1272s21c1
Sequence:CCGGTCGATATGATCTCGTCCTTATCTCGAGATAAGGACGAGATCATATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153404.2-1013s21c1
Sequence:CCGGGCGTAAGAAGAGGGTTTATTACTCGAGTAATAAACCCTCTTCTTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153404.2-799s21c1
Sequence:CCGGTGCGACTCCTATCGGGATTATCTCGAGATAATCCCGATAGGAGTCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153404
LIPH MISSION shRNA shRNA Plasmid DNA
lipase, member H
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153404.1-1593s1c1
Sequence:CCGGCCCTACAGCAAAGCACTTTGTCTCGAGACAAAGTGCTTTGCTGTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153404.2-1503s21c1
Sequence:CCGGTGTCAAAGGACCTGCGATTATCTCGAGATAATCGCAGGTCCTTTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153404.2-963s1c1
Sequence:CCGGGCCATACTGCATGTATCATTACTCGAGTAATGATACATGCAGTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153404.2-696s1c1
Sequence:CCGGCTCTGACACTGACGGTATAAACTCGAGTTTATACCGTCAGTGTCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153404.2-1013s1c1
Sequence:CCGGGCGTAAGAAGAGGGTTTATTACTCGAGTAATAAACCCTCTTCTTACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153404.2-1117s21c1
Sequence:CCGGGTGAGTCTCCTCGCAAGATTTCTCGAGAAATCTTGCGAGGAGACTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153404.2-1272s21c1
Sequence:CCGGTCGATATGATCTCGTCCTTATCTCGAGATAAGGACGAGATCATATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153404.2-1013s21c1
Sequence:CCGGGCGTAAGAAGAGGGTTTATTACTCGAGTAATAAACCCTCTTCTTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153404.2-799s21c1
Sequence:CCGGTGCGACTCCTATCGGGATTATCTCGAGATAATCCCGATAGGAGTCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153404
LIPH MISSION shRNA Lentiviral Transduction Particles
lipase, member H
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153404.1-1593s1c1
Sequence:CCGGCCCTACAGCAAAGCACTTTGTCTCGAGACAAAGTGCTTTGCTGTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153404.2-1503s21c1
Sequence:CCGGTGTCAAAGGACCTGCGATTATCTCGAGATAATCGCAGGTCCTTTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215689    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153404.2-963s1c1
Sequence:CCGGGCCATACTGCATGTATCATTACTCGAGTAATGATACATGCAGTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216925    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153404.2-696s1c1
Sequence:CCGGCTCTGACACTGACGGTATAAACTCGAGTTTATACCGTCAGTGTCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153404.2-1013s1c1
Sequence:CCGGGCGTAAGAAGAGGGTTTATTACTCGAGTAATAAACCCTCTTCTTACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153404.2-1117s21c1
Sequence:CCGGGTGAGTCTCCTCGCAAGATTTCTCGAGAAATCTTGCGAGGAGACTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153404.2-1272s21c1
Sequence:CCGGTCGATATGATCTCGTCCTTATCTCGAGATAAGGACGAGATCATATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153404.2-1013s21c1
Sequence:CCGGGCGTAAGAAGAGGGTTTATTACTCGAGTAATAAACCCTCTTCTTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153404.2-799s21c1
Sequence:CCGGTGCGACTCCTATCGGGATTATCTCGAGATAATCCCGATAGGAGTCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)