EMAIL THIS PAGE TO A FRIEND

LIPI

lipase, member I

66 Gene Product Result for
Synonyms: CT17 LPDL PLA1C
UniProtKB ID: Q6XZB0
Gene ID:
Human(149998) Summary: The protein encoded by this gene is a phospholipase that hydrolyzes phosphatidic acid to produce lysophosphatidic acid. The encoded protein, which can be inhibited by sodium vanadate, may be found exclusively in sperm. Defects in this gene are a cause of susceptibility to familial hypertrigliceridemia. [provided by RefSeq, Jun 2010]
Mouse(320355) lipase, member I
Rat(288322) lipase, member I
sheep(101122756) lipase, member I
naked mole-rat(101711749) lipase, member I
Zebrafish(100003046) lipase, member I
chicken(418466) lipase, member I
cow(617574) lipase, member I
Horse(100068765) lipase, member I
domestic cat(101095845) lipase, member I
dog(608069) lipase, member I
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177142 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177142 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177142 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198996 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198996 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198996 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032371 MISSION® esiRNA esiRNA human LIPI (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198996 Rosetta Predictions human pricing
NM_001105899 Rosetta Predictions rat pricing
NM_177142 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040059 predicted 372
2 SASI_Hs01_00040060 predicted 1093
3 SASI_Hs01_00040061 predicted 1052
4 SASI_Hs01_00040062 predicted 971
5 SASI_Hs01_00040063 predicted 1312
6 SASI_Hs01_00040064 predicted 1090
7 SASI_Hs01_00040065 predicted 834
8 SASI_Hs01_00040066 predicted 917
9 SASI_Hs01_00040067 predicted 1063
10 SASI_Hs02_00372512 predicted 300
11 SASI_Hs01_00040068 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213632 predicted 987
2 SASI_Rn02_00213633 predicted 732
3 SASI_Rn02_00213634 predicted 1426
4 SASI_Rn02_00213635 predicted 1291
5 SASI_Rn02_00213636 predicted 1453
6 SASI_Rn02_00213637 predicted 1628
7 SASI_Rn02_00213638 predicted 1588
8 SASI_Rn02_00213639 predicted 1493
9 SASI_Rn02_00213640 predicted 745
10 SASI_Rn02_00213641 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033524 predicted 1023
2 SASI_Mm01_00033525 predicted 1046
3 SASI_Mm01_00033526 predicted 860
4 SASI_Mm01_00033527 predicted 975
5 SASI_Mm01_00033528 predicted 859
6 SASI_Mm01_00033529 predicted 764
7 SASI_Mm01_00033530 predicted 669
8 SASI_Mm01_00033531 predicted 721
9 SASI_Mm02_00347139 predicted 692
10 SASI_Mm01_00033532 predicted 1000
11 SASI_Mm01_00033533 predicted 780
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177142
LIPI MISSION shRNA Bacterial Glycerol Stock
lipase, member I
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177142.3-666s21c1
Sequence:CCGGTGGAATACTCAACACTCTATGCTCGAGCATAGAGTGTTGAGTATTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177142.3-750s21c1
Sequence:CCGGTTGTGAGCATTTCGCGCATTTCTCGAGAAATGCGCGAAATGCTCACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177142.3-1196s21c1
Sequence:CCGGACATCTGCTGCTTAGCTTAATCTCGAGATTAAGCTAAGCAGCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177142.3-724s1c1
Sequence:CCGGGATTCTTGTTCAGTTCGTAAACTCGAGTTTACGAACTGAACAAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177142.3-777s1c1
Sequence:CCGGCATACTTTCAGTCCACAAATCCTCGAGGATTTGTGGACTGAAAGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177142.3-688s1c1
Sequence:CCGGGAAGAGCAAGCCATTTGATAACTCGAGTTATCAAATGGCTTGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177142.3-866s21c1
Sequence:CCGGCCACCAATTTGTAAGTATAATCTCGAGATTATACTTACAAATTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177142.3-725s21c1
Sequence:CCGGATTCTTGTTCAGTTCGTAAATCTCGAGATTTACGAACTGAACAAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201764    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177142.2-1161s1c1
Sequence:CCGGGCCTGCTTCCTAAGTGAATTTCTCGAGAAATTCACTTAGGAAGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177142.2-865s1c1
Sequence:CCGGGACCACCAATTTGTAAGTATACTCGAGTATACTTACAAATTGGTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177142.2-1053s1c1
Sequence:CCGGCCAGGTATATCTACCTTAATTCTCGAGAATTAAGGTAGATATACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177142
LIPI MISSION shRNA shRNA Plasmid DNA
lipase, member I
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177142.3-666s21c1
Sequence:CCGGTGGAATACTCAACACTCTATGCTCGAGCATAGAGTGTTGAGTATTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177142.3-750s21c1
Sequence:CCGGTTGTGAGCATTTCGCGCATTTCTCGAGAAATGCGCGAAATGCTCACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177142.3-1196s21c1
Sequence:CCGGACATCTGCTGCTTAGCTTAATCTCGAGATTAAGCTAAGCAGCAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177142.3-724s1c1
Sequence:CCGGGATTCTTGTTCAGTTCGTAAACTCGAGTTTACGAACTGAACAAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177142.3-777s1c1
Sequence:CCGGCATACTTTCAGTCCACAAATCCTCGAGGATTTGTGGACTGAAAGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177142.3-688s1c1
Sequence:CCGGGAAGAGCAAGCCATTTGATAACTCGAGTTATCAAATGGCTTGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177142.3-866s21c1
Sequence:CCGGCCACCAATTTGTAAGTATAATCTCGAGATTATACTTACAAATTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177142.3-725s21c1
Sequence:CCGGATTCTTGTTCAGTTCGTAAATCTCGAGATTTACGAACTGAACAAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201764    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177142.2-1161s1c1
Sequence:CCGGGCCTGCTTCCTAAGTGAATTTCTCGAGAAATTCACTTAGGAAGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177142.2-865s1c1
Sequence:CCGGGACCACCAATTTGTAAGTATACTCGAGTATACTTACAAATTGGTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177142.2-1053s1c1
Sequence:CCGGCCAGGTATATCTACCTTAATTCTCGAGAATTAAGGTAGATATACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177142
LIPI MISSION shRNA Lentiviral Transduction Particles
lipase, member I
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177142.3-666s21c1
Sequence:CCGGTGGAATACTCAACACTCTATGCTCGAGCATAGAGTGTTGAGTATTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177142.3-750s21c1
Sequence:CCGGTTGTGAGCATTTCGCGCATTTCTCGAGAAATGCGCGAAATGCTCACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177142.3-1196s21c1
Sequence:CCGGACATCTGCTGCTTAGCTTAATCTCGAGATTAAGCTAAGCAGCAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177142.3-724s1c1
Sequence:CCGGGATTCTTGTTCAGTTCGTAAACTCGAGTTTACGAACTGAACAAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177142.3-777s1c1
Sequence:CCGGCATACTTTCAGTCCACAAATCCTCGAGGATTTGTGGACTGAAAGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177142.3-688s1c1
Sequence:CCGGGAAGAGCAAGCCATTTGATAACTCGAGTTATCAAATGGCTTGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177142.3-866s21c1
Sequence:CCGGCCACCAATTTGTAAGTATAATCTCGAGATTATACTTACAAATTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177142.3-725s21c1
Sequence:CCGGATTCTTGTTCAGTTCGTAAATCTCGAGATTTACGAACTGAACAAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201764    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177142.2-1161s1c1
Sequence:CCGGGCCTGCTTCCTAAGTGAATTTCTCGAGAAATTCACTTAGGAAGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177142.2-865s1c1
Sequence:CCGGGACCACCAATTTGTAAGTATACTCGAGTATACTTACAAATTGGTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191194    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177142.2-1053s1c1
Sequence:CCGGCCAGGTATATCTACCTTAATTCTCGAGAATTAAGGTAGATATACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198996
LIPI MISSION shRNA Bacterial Glycerol Stock
lipase, member I
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.1-1303s1c1
Sequence:CCGGGCAGTGTTCCACATGCACATACTCGAGTATGTGCATGTGGAACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.1-650s1c1
Sequence:CCGGCCACCATATAGCAGATTAGATCTCGAGATCTAATCTGCTATATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.1-983s1c1
Sequence:CCGGGCCAAGCTATTTAAAGGTGTTCTCGAGAACACCTTTAAATAGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.1-151s1c1
Sequence:CCGGGCTAAGTGTAAAGGATTCCTTCTCGAGAAGGAATCCTTTACACTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.1-853s1c1
Sequence:CCGGCATGGCATCTTTAGAAACAAACTCGAGTTTGTTTCTAAAGATGCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198996.2-158s1c1
Sequence:CCGGGTAAAGGATTCCTTCAGAGATCTCGAGATCTCTGAAGGAATCCTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.2-663s1c1
Sequence:CCGGGATTAGATTACACGGATGCAACTCGAGTTGCATCCGTGTAATCTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198996.2-1462s1c1
Sequence:CCGGCTTCTTCCATCAAATGCACTTCTCGAGAAGTGCATTTGATGGAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198996.2-845s1c1
Sequence:CCGGCACTTGTTCATGGCATCTTTACTCGAGTAAAGATGCCATGAACAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.2-350s1c1
Sequence:CCGGCTTCAGAACTTCGTAAGGATTCTCGAGAATCCTTACGAAGTTCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.2-151s1c1
Sequence:CCGGGCTAAGTGTAAAGGATTCCTTCTCGAGAAGGAATCCTTTACACTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.2-983s1c1
Sequence:CCGGGCCAAGCTATTTAAAGGTGTTCTCGAGAACACCTTTAAATAGCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198996.2-557s1c1
Sequence:CCGGGCTCATATCAGTGGATTTGTTCTCGAGAACAAATCCACTGATATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198996
LIPI MISSION shRNA shRNA Plasmid DNA
lipase, member I
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.1-1303s1c1
Sequence:CCGGGCAGTGTTCCACATGCACATACTCGAGTATGTGCATGTGGAACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.1-650s1c1
Sequence:CCGGCCACCATATAGCAGATTAGATCTCGAGATCTAATCTGCTATATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.1-983s1c1
Sequence:CCGGGCCAAGCTATTTAAAGGTGTTCTCGAGAACACCTTTAAATAGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.1-151s1c1
Sequence:CCGGGCTAAGTGTAAAGGATTCCTTCTCGAGAAGGAATCCTTTACACTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.1-853s1c1
Sequence:CCGGCATGGCATCTTTAGAAACAAACTCGAGTTTGTTTCTAAAGATGCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198996.2-158s1c1
Sequence:CCGGGTAAAGGATTCCTTCAGAGATCTCGAGATCTCTGAAGGAATCCTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.2-663s1c1
Sequence:CCGGGATTAGATTACACGGATGCAACTCGAGTTGCATCCGTGTAATCTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198996.2-1462s1c1
Sequence:CCGGCTTCTTCCATCAAATGCACTTCTCGAGAAGTGCATTTGATGGAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198996.2-845s1c1
Sequence:CCGGCACTTGTTCATGGCATCTTTACTCGAGTAAAGATGCCATGAACAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.2-350s1c1
Sequence:CCGGCTTCAGAACTTCGTAAGGATTCTCGAGAATCCTTACGAAGTTCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.2-151s1c1
Sequence:CCGGGCTAAGTGTAAAGGATTCCTTCTCGAGAAGGAATCCTTTACACTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.2-983s1c1
Sequence:CCGGGCCAAGCTATTTAAAGGTGTTCTCGAGAACACCTTTAAATAGCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198996.2-557s1c1
Sequence:CCGGGCTCATATCAGTGGATTTGTTCTCGAGAACAAATCCACTGATATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198996
LIPI MISSION shRNA Lentiviral Transduction Particles
lipase, member I
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.1-1303s1c1
Sequence:CCGGGCAGTGTTCCACATGCACATACTCGAGTATGTGCATGTGGAACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.1-650s1c1
Sequence:CCGGCCACCATATAGCAGATTAGATCTCGAGATCTAATCTGCTATATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.1-983s1c1
Sequence:CCGGGCCAAGCTATTTAAAGGTGTTCTCGAGAACACCTTTAAATAGCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.1-151s1c1
Sequence:CCGGGCTAAGTGTAAAGGATTCCTTCTCGAGAAGGAATCCTTTACACTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.1-853s1c1
Sequence:CCGGCATGGCATCTTTAGAAACAAACTCGAGTTTGTTTCTAAAGATGCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198996.2-158s1c1
Sequence:CCGGGTAAAGGATTCCTTCAGAGATCTCGAGATCTCTGAAGGAATCCTTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.2-663s1c1
Sequence:CCGGGATTAGATTACACGGATGCAACTCGAGTTGCATCCGTGTAATCTAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198996.2-1462s1c1
Sequence:CCGGCTTCTTCCATCAAATGCACTTCTCGAGAAGTGCATTTGATGGAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198996.2-845s1c1
Sequence:CCGGCACTTGTTCATGGCATCTTTACTCGAGTAAAGATGCCATGAACAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.2-350s1c1
Sequence:CCGGCTTCAGAACTTCGTAAGGATTCTCGAGAATCCTTACGAAGTTCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.2-151s1c1
Sequence:CCGGGCTAAGTGTAAAGGATTCCTTCTCGAGAAGGAATCCTTTACACTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198996.2-983s1c1
Sequence:CCGGGCCAAGCTATTTAAAGGTGTTCTCGAGAACACCTTTAAATAGCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198996.2-557s1c1
Sequence:CCGGGCTCATATCAGTGGATTTGTTCTCGAGAACAAATCCACTGATATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)