EMAIL THIS PAGE TO A FRIEND

LIPK

lipase, family member K

51 Gene Product Result for
Synonyms: LIPL2 bA186O14.2
UniProtKB ID: Q5VXJ0, A7KIH8
Gene ID:
Mouse(240633) lipase, family member K
Rat(294094) lipase, family member K
sheep(101119862) lipase, family member K
Domestic Rabbit(100339511) lipase, family member K
domestic guinea pig(100724490) lipase, family member K
naked mole-rat(101703309) lipase, family member K
dog(486465) lipase, family member K
domestic cat(101092294) lipase, family member K
cow(507578) lipase, family member K
Horse(100062243) lipase, family member K
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301823 ANTI-LIPK (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172837 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172837 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172837 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080518 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080518 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080518 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080518 Rosetta Predictions human pricing
XM_926746 Rosetta Predictions human pricing
NM_001106374 Rosetta Predictions rat pricing
NM_172837 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315617 predicted 484
2 SASI_Hs02_00315618 predicted 816
3 SASI_Hs02_00315619 predicted 747
4 SASI_Hs02_00315620 predicted 820
5 SASI_Hs02_00315621 predicted 267
6 SASI_Hs02_00315622 predicted 319
7 SASI_Hs02_00315623 predicted 313
8 SASI_Hs02_00315624 predicted 930
9 SASI_Hs02_00315625 predicted 954
10 SASI_Hs02_00315626 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282797 predicted 757
2 SASI_Hs01_00282798 predicted 777
3 SASI_Hs01_00282799 predicted 245
4 SASI_Hs01_00282800 predicted 791
5 SASI_Hs01_00282801 predicted 271
6 SASI_Hs01_00282802 predicted 765
7 SASI_Hs01_00282803 predicted 727
8 SASI_Hs01_00282804 predicted 744
9 SASI_Hs01_00282805 predicted 758
10 SASI_Hs01_00282806 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106374 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218338 predicted 359
2 SASI_Rn02_00218339 predicted 1164
3 SASI_Rn02_00218340 predicted 422
4 SASI_Rn02_00218341 predicted 991
5 SASI_Rn02_00218342 predicted 916
6 SASI_Rn02_00218343 predicted 1353
7 SASI_Rn02_00218344 predicted 549
8 SASI_Rn02_00218345 predicted 1163
9 SASI_Rn02_00218346 predicted 313
10 SASI_Rn02_00218347 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172837 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158810 predicted 1055
2 SASI_Mm01_00158811 predicted 388
3 SASI_Mm01_00158812 predicted 368
4 SASI_Mm01_00158813 predicted 1197
5 SASI_Mm01_00158814 predicted 646
6 SASI_Mm01_00158815 predicted 535
7 SASI_Mm01_00158816 predicted 921
8 SASI_Mm02_00344769 predicted 989
9 SASI_Mm01_00158817 predicted 1375
10 SASI_Mm01_00158818 predicted 1052
11 SASI_Mm01_00158819 predicted 847
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172837
LIPK MISSION shRNA Bacterial Glycerol Stock
lipase, family member K
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172837.1-1038s1c1
Sequence:CCGGCCAGAACATGATGCACTTCAACTCGAGTTGAAGTGCATCATGTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172837.1-1912s1c1
Sequence:CCGGCCAACCATTAAGATATAGCAACTCGAGTTGCTATATCTTAATGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172837.1-1182s1c1
Sequence:CCGGCCTTATCTACTACAAGGAGATCTCGAGATCTCCTTGTAGTAGATAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172837.1-356s1c1
Sequence:CCGGGCTTAATTGCATCTGCCAATACTCGAGTATTGGCAGATGCAATTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172837.1-492s1c1
Sequence:CCGGGTCACCTAAATCACCGCAATACTCGAGTATTGCGGTGATTTAGGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172837.1-844s1c1
Sequence:CCGGCGGAAGTTATTCCATCAGCTACTCGAGTAGCTGATGGAATAACTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172837
LIPK MISSION shRNA shRNA Plasmid DNA
lipase, family member K
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172837.1-1038s1c1
Sequence:CCGGCCAGAACATGATGCACTTCAACTCGAGTTGAAGTGCATCATGTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172837.1-1912s1c1
Sequence:CCGGCCAACCATTAAGATATAGCAACTCGAGTTGCTATATCTTAATGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172837.1-1182s1c1
Sequence:CCGGCCTTATCTACTACAAGGAGATCTCGAGATCTCCTTGTAGTAGATAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172837.1-356s1c1
Sequence:CCGGGCTTAATTGCATCTGCCAATACTCGAGTATTGGCAGATGCAATTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172837.1-492s1c1
Sequence:CCGGGTCACCTAAATCACCGCAATACTCGAGTATTGCGGTGATTTAGGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172837.1-844s1c1
Sequence:CCGGCGGAAGTTATTCCATCAGCTACTCGAGTAGCTGATGGAATAACTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172837
LIPK MISSION shRNA Lentiviral Transduction Particles
lipase, family member K
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172837.1-1038s1c1
Sequence:CCGGCCAGAACATGATGCACTTCAACTCGAGTTGAAGTGCATCATGTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172837.1-1912s1c1
Sequence:CCGGCCAACCATTAAGATATAGCAACTCGAGTTGCTATATCTTAATGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172837.1-1182s1c1
Sequence:CCGGCCTTATCTACTACAAGGAGATCTCGAGATCTCCTTGTAGTAGATAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172837.1-356s1c1
Sequence:CCGGGCTTAATTGCATCTGCCAATACTCGAGTATTGGCAGATGCAATTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172837.1-492s1c1
Sequence:CCGGGTCACCTAAATCACCGCAATACTCGAGTATTGCGGTGATTTAGGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172837.1-844s1c1
Sequence:CCGGCGGAAGTTATTCCATCAGCTACTCGAGTAGCTGATGGAATAACTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080518
LIPK MISSION shRNA Bacterial Glycerol Stock
lipase, family member K
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080518.1-648s21c1
Sequence:CCGGCCTTTCCAGGCGAGTAGTTAACTCGAGTTAACTACTCGCCTGGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080518.1-965s21c1
Sequence:CCGGCACCTCCTTTATACAACATTACTCGAGTAATGTTGTATAAAGGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080518.1-391s21c1
Sequence:CCGGTCACCGAAATCACCGGAATACCTCGAGGTATTCCGGTGATTTCGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080518.1-41s21c1
Sequence:CCGGTTGGATCTATGTATGGTTATGCTCGAGCATAACCATACATAGATCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080518.1-743s21c1
Sequence:CCGGGAAAGCTATTCCGTCGTATTTCTCGAGAAATACGACGGAATAGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080518
LIPK MISSION shRNA shRNA Plasmid DNA
lipase, family member K
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080518.1-648s21c1
Sequence:CCGGCCTTTCCAGGCGAGTAGTTAACTCGAGTTAACTACTCGCCTGGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080518.1-965s21c1
Sequence:CCGGCACCTCCTTTATACAACATTACTCGAGTAATGTTGTATAAAGGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080518.1-391s21c1
Sequence:CCGGTCACCGAAATCACCGGAATACCTCGAGGTATTCCGGTGATTTCGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080518.1-41s21c1
Sequence:CCGGTTGGATCTATGTATGGTTATGCTCGAGCATAACCATACATAGATCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080518.1-743s21c1
Sequence:CCGGGAAAGCTATTCCGTCGTATTTCTCGAGAAATACGACGGAATAGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080518
LIPK MISSION shRNA Lentiviral Transduction Particles
lipase, family member K
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080518.1-648s21c1
Sequence:CCGGCCTTTCCAGGCGAGTAGTTAACTCGAGTTAACTACTCGCCTGGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080518.1-965s21c1
Sequence:CCGGCACCTCCTTTATACAACATTACTCGAGTAATGTTGTATAAAGGAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080518.1-391s21c1
Sequence:CCGGTCACCGAAATCACCGGAATACCTCGAGGTATTCCGGTGATTTCGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080518.1-41s21c1
Sequence:CCGGTTGGATCTATGTATGGTTATGCTCGAGCATAACCATACATAGATCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080518.1-743s21c1
Sequence:CCGGGAAAGCTATTCCGTCGTATTTCTCGAGAAATACGACGGAATAGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)