EMAIL THIS PAGE TO A FRIEND

LIPM

lipase, family member M

58 Gene Product Result for
Synonyms: LIPL3 bA304I5.1
UniProtKB ID: Q5VYY2, A6PVS3, B5MCR3
Gene ID:
Mouse(78753) lipase, family member M
Rat(309528) lipase, family member M
Horse(100071658) lipase, family member M
cow(517290) lipase, family member M
domestic cat(101092791) lipase, family member M
dog(610497) lipase, family member M
domestic guinea pig(100725314) lipase, family member M
naked mole-rat(101704038) lipase, family member M
sheep(101120285) lipase, family member M
Domestic Rabbit(100340012) lipase, family member M
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301330 ANTI-LIPM (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2107837 Anti-LIPM antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_291663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_291663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_291663 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU204901 MISSION® esiRNA esiRNA targeting mouse Lipm mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128215 Rosetta Predictions human pricing
XM_291663 Rosetta Predictions human pricing
XM_001079892 Rosetta Predictions rat pricing
XM_220066 Rosetta Predictions rat pricing
NM_023903 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330896 predicted 234
2 SASI_Hs02_00330897 predicted 960
3 SASI_Hs02_00330898 predicted 921
4 SASI_Hs02_00330899 predicted 954
5 SASI_Hs02_00330900 predicted 297
6 SASI_Hs02_00330901 predicted 976
7 SASI_Hs02_00330902 predicted 946
8 SASI_Hs02_00330903 predicted 224
9 SASI_Hs02_00330904 predicted 931
10 SASI_Hs02_00330905 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_291663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292066 predicted 763
2 SASI_Hs01_00292067 predicted 868
3 SASI_Hs01_00292068 predicted 932
4 SASI_Hs01_00292069 predicted 723
5 SASI_Hs01_00292070 predicted 684
6 SASI_Hs01_00292071 predicted 720
7 SASI_Hs01_00292072 predicted 488
8 SASI_Hs01_00292073 predicted 745
9 SASI_Hs01_00292074 predicted 564
10 SASI_Hs01_00292075 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079892 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365874 predicted 861
2 SASI_Rn02_00365875 predicted 237
3 SASI_Rn02_00365876 predicted 593
4 SASI_Rn02_00365877 predicted 200
5 SASI_Rn02_00365878 predicted 260
6 SASI_Rn02_00365879 predicted 1051
7 SASI_Rn02_00365880 predicted 478
8 SASI_Rn02_00365881 predicted 364
9 SASI_Rn02_00365882 predicted 855
10 SASI_Rn02_00365883 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220066 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379005 predicted 862
2 SASI_Rn02_00379006 predicted 238
3 SASI_Rn02_00379007 predicted 593
4 SASI_Rn02_00379008 predicted 208
5 SASI_Rn02_00379009 predicted 260
6 SASI_Rn02_00379010 predicted 1052
7 SASI_Rn02_00379011 predicted 478
8 SASI_Rn02_00379012 predicted 366
9 SASI_Rn02_00379013 predicted 852
10 SASI_Rn02_00379014 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023903 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327448 predicted 412
2 SASI_Mm02_00327449 predicted 835
3 SASI_Mm02_00327450 predicted 928
4 SASI_Mm02_00327451 predicted 1148
5 SASI_Mm02_00327452 predicted 1200
6 SASI_Mm02_00327453 predicted 287
7 SASI_Mm02_00327454 predicted 772
8 SASI_Mm02_00327455 predicted 202
9 SASI_Mm02_00327456 predicted 614
10 SASI_Mm02_00327457 predicted 795
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_291663
LIPM MISSION shRNA Bacterial Glycerol Stock
lipase, family member M
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000050718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291663.2-825s1c1
Sequence:CCGGGAACATGAATACTCATGGTTTCTCGAGAAACCATGAGTATTCATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291663.2-414s1c1
Sequence:CCGGCCAAGATGAGTTCTGGGCTTTCTCGAGAAAGCCCAGAACTCATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291663.2-756s1c1
Sequence:CCGGCCAGGTGATTCTTGATCAGATCTCGAGATCTGATCAAGAATCACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291663.2-157s1c1
Sequence:CCGGGAATATGAAGTCGCAACTGAACTCGAGTTCAGTTGCGACTTCATATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_291663
LIPM MISSION shRNA shRNA Plasmid DNA
lipase, family member M
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000050718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291663.2-825s1c1
Sequence:CCGGGAACATGAATACTCATGGTTTCTCGAGAAACCATGAGTATTCATGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291663.2-414s1c1
Sequence:CCGGCCAAGATGAGTTCTGGGCTTTCTCGAGAAAGCCCAGAACTCATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291663.2-756s1c1
Sequence:CCGGCCAGGTGATTCTTGATCAGATCTCGAGATCTGATCAAGAATCACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291663.2-157s1c1
Sequence:CCGGGAATATGAAGTCGCAACTGAACTCGAGTTCAGTTGCGACTTCATATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_291663
LIPM MISSION shRNA Lentiviral Transduction Particles
lipase, family member M
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000050718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291663.2-825s1c1
Sequence:CCGGGAACATGAATACTCATGGTTTCTCGAGAAACCATGAGTATTCATGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291663.2-414s1c1
Sequence:CCGGCCAAGATGAGTTCTGGGCTTTCTCGAGAAAGCCCAGAACTCATCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291663.2-756s1c1
Sequence:CCGGCCAGGTGATTCTTGATCAGATCTCGAGATCTGATCAAGAATCACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291663.2-157s1c1
Sequence:CCGGGAATATGAAGTCGCAACTGAACTCGAGTTCAGTTGCGACTTCATATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)