EMAIL THIS PAGE TO A FRIEND

LIPN

lipase, family member N

83 Gene Product Result for
Synonyms: ARCI8 LI4 LIPL4 bA186O14.3
UniProtKB ID: Q5VXI9, A7KIH9
Gene ID:
Human(643418) Summary: The gene encodes a lipase that is highly expressed in granular keratinocytes in the epidermis, and plays a role in the differentiation of keratinocytes. Mutations in this gene are associated with lamellar ichthyosis type 4. [provided by RefSeq, Dec 2011]
Mouse(70166) lipase, family member N
Rat(499345) lipase, family member N
sheep(101123254) lipase, family member N
Domestic Rabbit(100339762) lipase, family member N
domestic guinea pig(100724769) lipase, family member N
naked mole-rat(101717023) lipase, family member N
Horse(100071663) lipase, family member N
cow(523964) lipase, family member N
domestic cat(101092545) lipase, family member N
dog(610475) lipase, family member N
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001102469 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001102469 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001102469 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027340 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027340 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027340 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102469 Rosetta Predictions human pricing
XM_926751 Rosetta Predictions human pricing
XM_001079884 Rosetta Predictions rat pricing
XM_574655 Rosetta Predictions rat pricing
NM_027340 Rosetta Predictions mouse pricing
XM_355173 Rosetta Predictions mouse pricing
XM_900789 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323193 predicted 892
2 SASI_Hs02_00323194 predicted 512
3 SASI_Hs02_00323195 predicted 328
4 SASI_Hs02_00323196 predicted 753
5 SASI_Hs02_00323197 predicted 711
6 SASI_Hs02_00323198 predicted 811
7 SASI_Hs02_00323199 predicted 401
8 SASI_Hs02_00323200 predicted 887
9 SASI_Hs02_00323201 predicted 781
10 SASI_Hs02_00323202 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249351 predicted 1114
2 SASI_Hs01_00249352 predicted 1069
3 SASI_Hs01_00249353 predicted 1101
4 SASI_Hs01_00249354 predicted 1072
5 SASI_Hs01_00249355 predicted 1040
6 SASI_Hs01_00249356 predicted 1032
7 SASI_Hs01_00249357 predicted 1042
8 SASI_Hs01_00249358 predicted 1060
9 SASI_Hs01_00249359 predicted 1062
10 SASI_Hs01_00249360 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079884 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365845 predicted 351
2 SASI_Rn02_00365846 predicted 725
3 SASI_Rn02_00365847 predicted 360
4 SASI_Rn02_00365848 predicted 562
5 SASI_Rn02_00365849 predicted 792
6 SASI_Rn02_00365850 predicted 722
7 SASI_Rn02_00365851 predicted 280
8 SASI_Rn02_00365852 predicted 511
9 SASI_Rn02_00365853 predicted 395
10 SASI_Rn02_00365854 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574655 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402350 predicted 354
2 SASI_Rn02_00402351 predicted 721
3 SASI_Rn02_00402352 predicted 361
4 SASI_Rn02_00402353 predicted 558
5 SASI_Rn02_00402354 predicted 791
6 SASI_Rn02_00402355 predicted 722
7 SASI_Rn02_00402356 predicted 285
8 SASI_Rn02_00402357 predicted 508
9 SASI_Rn02_00402358 predicted 396
10 SASI_Rn02_00402359 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027340 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331974 predicted 325
2 SASI_Mm02_00331975 predicted 719
3 SASI_Mm02_00331976 predicted 386
4 SASI_Mm02_00331977 predicted 655
5 SASI_Mm02_00331978 predicted 717
6 SASI_Mm02_00331979 predicted 331
7 SASI_Mm02_00331980 predicted 789
8 SASI_Mm02_00331981 predicted 794
9 SASI_Mm02_00331982 predicted 508
10 SASI_Mm02_00331983 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355173 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203382 predicted 1276
2 SASI_Mm01_00203383 predicted 1258
3 SASI_Mm01_00203384 predicted 1269
4 SASI_Mm01_00203385 predicted 1263
5 SASI_Mm01_00203386 predicted 1266
6 SASI_Mm01_00203387 predicted 1243
7 SASI_Mm01_00203388 predicted 1270
8 SASI_Mm01_00203389 predicted 1264
9 SASI_Mm01_00203390 predicted 1277
10 SASI_Mm01_00203391 predicted 1243
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206295 predicted 1052
2 SASI_Mm01_00206296 predicted 1054
3 SASI_Mm01_00206297 predicted 1072
4 SASI_Mm01_00206298 predicted 1047
5 SASI_Mm01_00206299 predicted 1050
6 SASI_Mm01_00206300 predicted 1240
7 SASI_Mm01_00206301 predicted 952
8 SASI_Mm01_00206302 predicted 798
9 SASI_Mm01_00206303 predicted 651
10 SASI_Mm01_00206304 predicted 921
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001102469
LIPN MISSION shRNA Bacterial Glycerol Stock
lipase, family member N
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102469.1-995s21c1
Sequence:CCGGTGAAAGTGCCTACTGCTATTTCTCGAGAAATAGCAGTAGGCACTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102469.1-595s21c1
Sequence:CCGGTTGGGTCCTACGATCTCATTCCTCGAGGAATGAGATCGTAGGACCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102469.1-758s21c1
Sequence:CCGGGGTTGATATGTAGCGAATTTACTCGAGTAAATTCGCTACATATCAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102469.1-446s21c1
Sequence:CCGGATGATCTCCCAGGAGTAATAGCTCGAGCTATTACTCCTGGGAGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102469.1-867s21c1
Sequence:CCGGACACAACATTCTGCATATAAACTCGAGTTTATATGCAGAATGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001102469
LIPN MISSION shRNA shRNA Plasmid DNA
lipase, family member N
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102469.1-995s21c1
Sequence:CCGGTGAAAGTGCCTACTGCTATTTCTCGAGAAATAGCAGTAGGCACTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102469.1-595s21c1
Sequence:CCGGTTGGGTCCTACGATCTCATTCCTCGAGGAATGAGATCGTAGGACCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102469.1-758s21c1
Sequence:CCGGGGTTGATATGTAGCGAATTTACTCGAGTAAATTCGCTACATATCAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102469.1-446s21c1
Sequence:CCGGATGATCTCCCAGGAGTAATAGCTCGAGCTATTACTCCTGGGAGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102469.1-867s21c1
Sequence:CCGGACACAACATTCTGCATATAAACTCGAGTTTATATGCAGAATGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001102469
LIPN MISSION shRNA Lentiviral Transduction Particles
lipase, family member N
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102469.1-995s21c1
Sequence:CCGGTGAAAGTGCCTACTGCTATTTCTCGAGAAATAGCAGTAGGCACTTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102469.1-595s21c1
Sequence:CCGGTTGGGTCCTACGATCTCATTCCTCGAGGAATGAGATCGTAGGACCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102469.1-758s21c1
Sequence:CCGGGGTTGATATGTAGCGAATTTACTCGAGTAAATTCGCTACATATCAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102469.1-446s21c1
Sequence:CCGGATGATCTCCCAGGAGTAATAGCTCGAGCTATTACTCCTGGGAGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102469.1-867s21c1
Sequence:CCGGACACAACATTCTGCATATAAACTCGAGTTTATATGCAGAATGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027340
LIPN MISSION shRNA Bacterial Glycerol Stock
lipase, family member N
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027340.2-266s21c1
Sequence:CCGGTTTGATACCTGGAACCTTAAGCTCGAGCTTAAGGTTCCAGGTATCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027340.2-1320s21c1
Sequence:CCGGCTACGCTACTTCAAGCAATTTCTCGAGAAATTGCTTGAAGTAGCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027340.2-553s21c1
Sequence:CCGGTACTAGCAGATGCAGGTTATGCTCGAGCATAACCTGCATCTGCTAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027340.2-681s21c1
Sequence:CCGGTATGACCTCCCAGGGATAATACTCGAGTATTATCCCTGGGAGGTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027340.2-954s21c1
Sequence:CCGGAGGATGTCATTTATCACATTCCTCGAGGAATGTGATAAATGACATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027340
LIPN MISSION shRNA shRNA Plasmid DNA
lipase, family member N
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027340.2-266s21c1
Sequence:CCGGTTTGATACCTGGAACCTTAAGCTCGAGCTTAAGGTTCCAGGTATCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027340.2-1320s21c1
Sequence:CCGGCTACGCTACTTCAAGCAATTTCTCGAGAAATTGCTTGAAGTAGCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027340.2-553s21c1
Sequence:CCGGTACTAGCAGATGCAGGTTATGCTCGAGCATAACCTGCATCTGCTAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027340.2-681s21c1
Sequence:CCGGTATGACCTCCCAGGGATAATACTCGAGTATTATCCCTGGGAGGTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027340.2-954s21c1
Sequence:CCGGAGGATGTCATTTATCACATTCCTCGAGGAATGTGATAAATGACATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027340
LIPN MISSION shRNA Lentiviral Transduction Particles
lipase, family member N
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027340.2-266s21c1
Sequence:CCGGTTTGATACCTGGAACCTTAAGCTCGAGCTTAAGGTTCCAGGTATCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027340.2-1320s21c1
Sequence:CCGGCTACGCTACTTCAAGCAATTTCTCGAGAAATTGCTTGAAGTAGCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027340.2-553s21c1
Sequence:CCGGTACTAGCAGATGCAGGTTATGCTCGAGCATAACCTGCATCTGCTAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027340.2-681s21c1
Sequence:CCGGTATGACCTCCCAGGGATAATACTCGAGTATTATCCCTGGGAGGTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027340.2-954s21c1
Sequence:CCGGAGGATGTCATTTATCACATTCCTCGAGGAATGTGATAAATGACATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)