EMAIL THIS PAGE TO A FRIEND

Lipo1

4 Gene Product Result for
Species: Mouse Lipo1(381236)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013770 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013770 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013770 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU145781 MISSION® esiRNA targeting mouse Lipo1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013770 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287306 predicted 590
2 SASI_Mm01_00173694 predicted 1344
3 SASI_Mm01_00173693 predicted 761
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013770
Lipo1 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013770.3-2494s21c1
Sequence:CCGGACTATGGCCAGTCTCAAATACCTCGAGGTATTTGAGACTGGCCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013770.3-2367s21c1
Sequence:CCGGCCTTGTAACAGAAATTGAATACTCGAGTATTCAATTTCTGTTACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013770.3-2312s21c1
Sequence:CCGGTAACCCACAAGAATGATCATTCTCGAGAATGATCATTCTTGTGGGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013770.3-1750s21c1
Sequence:CCGGTGAAGGTGATGTTCAGCTTTACTCGAGTAAAGCTGAACATCACCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013770.3-2263s21c1
Sequence:CCGGCTGAATTGAGAGAACAATAATCTCGAGATTATTGTTCTCTCAATTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013770
Lipo1 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013770.3-2494s21c1
Sequence:CCGGACTATGGCCAGTCTCAAATACCTCGAGGTATTTGAGACTGGCCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013770.3-2367s21c1
Sequence:CCGGCCTTGTAACAGAAATTGAATACTCGAGTATTCAATTTCTGTTACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013770.3-2312s21c1
Sequence:CCGGTAACCCACAAGAATGATCATTCTCGAGAATGATCATTCTTGTGGGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013770.3-1750s21c1
Sequence:CCGGTGAAGGTGATGTTCAGCTTTACTCGAGTAAAGCTGAACATCACCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013770.3-2263s21c1
Sequence:CCGGCTGAATTGAGAGAACAATAATCTCGAGATTATTGTTCTCTCAATTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013770
Lipo1 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013770.3-2494s21c1
Sequence:CCGGACTATGGCCAGTCTCAAATACCTCGAGGTATTTGAGACTGGCCATAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000251483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013770.3-2367s21c1
Sequence:CCGGCCTTGTAACAGAAATTGAATACTCGAGTATTCAATTTCTGTTACAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000251481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013770.3-2312s21c1
Sequence:CCGGTAACCCACAAGAATGATCATTCTCGAGAATGATCATTCTTGTGGGTTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000251480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013770.3-1750s21c1
Sequence:CCGGTGAAGGTGATGTTCAGCTTTACTCGAGTAAAGCTGAACATCACCTTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000251482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013770.3-2263s21c1
Sequence:CCGGCTGAATTGAGAGAACAATAATCTCGAGATTATTGTTCTCTCAATTCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???