EMAIL THIS PAGE TO A FRIEND

LIPT1

lipoyltransferase 1

89 Gene Product Result for
UniProtKB ID: Q9Y234, Q4ZFZ1
Gene ID:
Human(51601) Summary: The process of transferring lipoic acid to proteins is a two-step process. The first step is the activation of lipoic acid by lipoate-activating enzyme to form lipoyl-AMP. For the second step, the protein encoded by this gene transfers the lipoyl moiety to apoproteins. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 13. Read-through transcription also exists between this gene and the neighboring downstream mitochondrial ribosomal protein L30 (MRPL30) gene. [provided by RefSeq, Mar 2011]
Mouse(623661) lipoyltransferase 1
Rat(316342) lipoyltransferase 1
Zebrafish(334494) lipoyltransferase 1
chicken(418697) lipoyltransferase 1
cow(286864) lipoyltransferase 1
Horse(100050813) lipoyltransferase 1
domestic cat(101087655) lipoyltransferase 1
dog(100684917) lipoyltransferase 1
sheep(101107774) lipoyltransferase 1
Domestic Rabbit(100358591) lipoyltransferase 1
domestic guinea pig(100718684) lipoyltransferase 1
naked mole-rat(101696353) lipoyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV48784 Anti-LIPT1 antibody produced in rabbit affinity isolated antibody rat, canine, rabbit, human, mouse, bovine, guinea pig, horse
western blot pricing
HPA034802 Anti-LIPT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015929 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015929 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015929 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001037918 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037918 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037918 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015929 Rosetta Predictions human pricing
NM_145196 Rosetta Predictions human pricing
NM_145197 Rosetta Predictions human pricing
NM_145198 Rosetta Predictions human pricing
NM_145199 Rosetta Predictions human pricing
NM_001108212 Rosetta Predictions rat pricing
NM_001037918 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136077 predicted 1171
2 SASI_Hs01_00136078 predicted 1042
3 SASI_Hs01_00136079 predicted 1018
4 SASI_Hs01_00136080 predicted 1016
5 SASI_Hs01_00136081 predicted 1179
6 SASI_Hs01_00136082 predicted 1098
7 SASI_Hs01_00136083 predicted 837
8 SASI_Hs01_00136085 predicted 911
9 SASI_Hs01_00136086 predicted 809
10 SASI_Hs02_00348554 predicted 927
11 SASI_Hs01_00136084 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145199 predicted 1101
2 SASI_Hs01_00145200 predicted 985
3 SASI_Hs01_00145201 predicted 952
4 SASI_Hs01_00145202 predicted 954
5 SASI_Hs01_00145203 predicted 1118
6 SASI_Hs01_00145204 predicted 1032
7 SASI_Hs01_00145205 predicted 771
8 SASI_Hs01_00145207 predicted 854
9 SASI_Hs01_00145208 predicted 748
10 SASI_Hs02_00365041 predicted 868
11 SASI_Hs01_00145206 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173406 predicted 1297
2 SASI_Hs01_00173407 predicted 1177
3 SASI_Hs01_00173408 predicted 1141
4 SASI_Hs01_00173409 predicted 1147
5 SASI_Hs01_00173410 predicted 1313
6 SASI_Hs01_00173411 predicted 1226
7 SASI_Hs01_00173412 predicted 970
8 SASI_Hs01_00173414 predicted 1043
9 SASI_Hs01_00173415 predicted 946
10 SASI_Hs02_00365042 predicted 1054
11 SASI_Hs01_00173413 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047750 predicted 1286
2 SASI_Hs01_00047751 predicted 1158
3 SASI_Hs01_00047752 predicted 1133
4 SASI_Hs01_00047753 predicted 1131
5 SASI_Hs01_00047754 predicted 1298
6 SASI_Hs01_00047755 predicted 1212
7 SASI_Hs01_00047756 predicted 956
8 SASI_Hs01_00047758 predicted 1030
9 SASI_Hs01_00047759 predicted 929
10 SASI_Hs02_00365043 predicted 1040
11 SASI_Hs01_00047757 predicted 1250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109938 predicted 1041
2 SASI_Hs01_00109939 predicted 920
3 SASI_Hs01_00109940 predicted 887
4 SASI_Hs01_00109941 predicted 890
5 SASI_Hs01_00109942 predicted 1061
6 SASI_Hs01_00109943 predicted 970
7 SASI_Hs01_00109944 predicted 713
8 SASI_Hs01_00109946 predicted 785
9 SASI_Hs01_00109947 predicted 688
10 SASI_Hs02_00365044 predicted 800
11 SASI_Hs01_00109945 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108212 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236424 predicted 283
2 SASI_Rn02_00236425 predicted 1080
3 SASI_Rn02_00236426 predicted 382
4 SASI_Rn02_00236427 predicted 1004
5 SASI_Rn02_00236428 predicted 1137
6 SASI_Rn02_00236429 predicted 353
7 SASI_Rn02_00236430 predicted 1037
8 SASI_Rn02_00236431 predicted 581
9 SASI_Rn02_00236432 predicted 651
10 SASI_Rn02_00236433 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193780 predicted 881
2 SASI_Mm01_00193781 predicted 710
3 SASI_Mm01_00193782 predicted 280
4 SASI_Mm01_00193783 predicted 965
5 SASI_Mm02_00289522 predicted 787
6 SASI_Mm01_00193784 predicted 1237
7 SASI_Mm01_00193785 predicted 1302
8 SASI_Mm01_00193786 predicted 1034
9 SASI_Mm01_00193787 predicted 1230
10 SASI_Mm01_00193788 predicted 509
11 SASI_Mm01_00193789 predicted 999
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015929
VALIDATED
LIPT1 MISSION shRNA Bacterial Glycerol Stock
lipoyltransferase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015929.3-1288s21c1
Sequence:CCGGACCACAAACTAAACAGTAAATCTCGAGATTTACTGTTTAGTTTGTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015929.3-395s21c1
Sequence:CCGGAGAAGGCAAACCAATTCTATTCTCGAGAATAGAATTGGTTTGCCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015929.3-470s21c1
Sequence:CCGGGGAATGTAACCTGAATCTAATCTCGAGATTAGATTCAGGTTACATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015929.3-1242s21c1
Sequence:CCGGGAAACTACCATGCTAACAAATCTCGAGATTTGTTAGCATGGTAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015929.3-770s21c1
Sequence:CCGGTAGTACTGATGGGACGTTCTTCTCGAGAAGAACGTCCCATCAGTACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015929.2-1182s1c1
Sequence:CCGGCCATTGGAAATACGTGACAAACTCGAGTTTGTCACGTATTTCCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_015929.2-745s1c1
Sequence:CCGGCCTATCACCATTGCACTTTATCTCGAGATAAAGTGCAATGGTGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015929.2-542s1c1
Sequence:CCGGCTACCATGATATGGGTAATATCTCGAGATATTACCCATATCATGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_015929.2-930s1c1
Sequence:CCGGGCTGCTTATCATCAAATTGATCTCGAGATCAATTTGATGATAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_015929.2-1006s1c1
Sequence:CCGGGCAAAGCCAAAGAACTGCAAACTCGAGTTTGCAGTTCTTTGGCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015929
VALIDATED
LIPT1 MISSION shRNA shRNA Plasmid DNA
lipoyltransferase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015929.3-1288s21c1
Sequence:CCGGACCACAAACTAAACAGTAAATCTCGAGATTTACTGTTTAGTTTGTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015929.3-395s21c1
Sequence:CCGGAGAAGGCAAACCAATTCTATTCTCGAGAATAGAATTGGTTTGCCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015929.3-470s21c1
Sequence:CCGGGGAATGTAACCTGAATCTAATCTCGAGATTAGATTCAGGTTACATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015929.3-1242s21c1
Sequence:CCGGGAAACTACCATGCTAACAAATCTCGAGATTTGTTAGCATGGTAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015929.3-770s21c1
Sequence:CCGGTAGTACTGATGGGACGTTCTTCTCGAGAAGAACGTCCCATCAGTACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015929.2-1182s1c1
Sequence:CCGGCCATTGGAAATACGTGACAAACTCGAGTTTGTCACGTATTTCCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_015929.2-745s1c1
Sequence:CCGGCCTATCACCATTGCACTTTATCTCGAGATAAAGTGCAATGGTGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015929.2-542s1c1
Sequence:CCGGCTACCATGATATGGGTAATATCTCGAGATATTACCCATATCATGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_015929.2-930s1c1
Sequence:CCGGGCTGCTTATCATCAAATTGATCTCGAGATCAATTTGATGATAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_015929.2-1006s1c1
Sequence:CCGGGCAAAGCCAAAGAACTGCAAACTCGAGTTTGCAGTTCTTTGGCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015929
VALIDATED
LIPT1 MISSION shRNA Lentiviral Transduction Particles
lipoyltransferase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015929.3-1288s21c1
Sequence:CCGGACCACAAACTAAACAGTAAATCTCGAGATTTACTGTTTAGTTTGTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015929.3-395s21c1
Sequence:CCGGAGAAGGCAAACCAATTCTATTCTCGAGAATAGAATTGGTTTGCCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015929.3-470s21c1
Sequence:CCGGGGAATGTAACCTGAATCTAATCTCGAGATTAGATTCAGGTTACATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015929.3-1242s21c1
Sequence:CCGGGAAACTACCATGCTAACAAATCTCGAGATTTGTTAGCATGGTAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015929.3-770s21c1
Sequence:CCGGTAGTACTGATGGGACGTTCTTCTCGAGAAGAACGTCCCATCAGTACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015929.2-1182s1c1
Sequence:CCGGCCATTGGAAATACGTGACAAACTCGAGTTTGTCACGTATTTCCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_015929.2-745s1c1
Sequence:CCGGCCTATCACCATTGCACTTTATCTCGAGATAAAGTGCAATGGTGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015929.2-542s1c1
Sequence:CCGGCTACCATGATATGGGTAATATCTCGAGATATTACCCATATCATGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_015929.2-930s1c1
Sequence:CCGGGCTGCTTATCATCAAATTGATCTCGAGATCAATTTGATGATAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_015929.2-1006s1c1
Sequence:CCGGGCAAAGCCAAAGAACTGCAAACTCGAGTTTGCAGTTCTTTGGCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037918
VALIDATED
LIPT1 MISSION shRNA Bacterial Glycerol Stock
lipoyltransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001037918.3-1356s21c1
Sequence:CCGGGAGGTGGCCTGTCCCTAATTTCTCGAGAAATTAGGGACAGGCCACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001037918.3-1040s21c1
Sequence:CCGGATCGAAACCTGCGCTATTAAGCTCGAGCTTAATAGCGCAGGTTTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001037918.3-582s21c1
Sequence:CCGGTGCTACTCGACGGGCAGTTTACTCGAGTAAACTGCCCGTCGAGTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001037918.3-226s21c1
Sequence:CCGGGTCGATCTCCAATGATGTATACTCGAGTATACATCATTGGAGATCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001037918.3-267s21c1
Sequence:CCGGACTGGATCCACGACCACATACCTCGAGGTATGTGGTCGTGGATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037918
VALIDATED
LIPT1 MISSION shRNA shRNA Plasmid DNA
lipoyltransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001037918.3-1356s21c1
Sequence:CCGGGAGGTGGCCTGTCCCTAATTTCTCGAGAAATTAGGGACAGGCCACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001037918.3-1040s21c1
Sequence:CCGGATCGAAACCTGCGCTATTAAGCTCGAGCTTAATAGCGCAGGTTTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001037918.3-582s21c1
Sequence:CCGGTGCTACTCGACGGGCAGTTTACTCGAGTAAACTGCCCGTCGAGTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001037918.3-226s21c1
Sequence:CCGGGTCGATCTCCAATGATGTATACTCGAGTATACATCATTGGAGATCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001037918.3-267s21c1
Sequence:CCGGACTGGATCCACGACCACATACCTCGAGGTATGTGGTCGTGGATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037918
VALIDATED
LIPT1 MISSION shRNA Lentiviral Transduction Particles
lipoyltransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001037918.3-1356s21c1
Sequence:CCGGGAGGTGGCCTGTCCCTAATTTCTCGAGAAATTAGGGACAGGCCACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001037918.3-1040s21c1
Sequence:CCGGATCGAAACCTGCGCTATTAAGCTCGAGCTTAATAGCGCAGGTTTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001037918.3-582s21c1
Sequence:CCGGTGCTACTCGACGGGCAGTTTACTCGAGTAAACTGCCCGTCGAGTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001037918.3-226s21c1
Sequence:CCGGGTCGATCTCCAATGATGTATACTCGAGTATACATCATTGGAGATCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001037918.3-267s21c1
Sequence:CCGGACTGGATCCACGACCACATACCTCGAGGTATGTGGTCGTGGATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)