EMAIL THIS PAGE TO A FRIEND

LIPT2

lipoyl(octanoyl) transferase 2 (putative)

79 Gene Product Result for
UniProtKB ID: A6NK58
Gene ID:
Mouse(67164) lipoyl(octanoyl) transferase 2 (putative)
Rat(365314) lipoyl(octanoyl) transferase 2 (putative)
Zebrafish(664765) lipoyl(octanoyl) transferase 2 (putative)
cow(527628) lipoyl(octanoyl) transferase 2 (putative)
domestic cat(101093960) lipoyl(octanoyl) transferase 2 (putative)
dog(485196) lipoyl(octanoyl) transferase 2 (putative)
domestic guinea pig(100734871) lipoyl(octanoyl) transferase 2 (putative)
naked mole-rat(101709456) lipoyl(octanoyl) transferase 2 (putative)
sheep(101105357) lipoyl(octanoyl) transferase 2 (putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026010 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026010 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026010 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001144869 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001144869 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001144869 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_370636 Rosetta Predictions human pricing
XM_930465 Rosetta Predictions human pricing
XR_039115 Rosetta Predictions human pricing
XR_039136 Rosetta Predictions human pricing
XR_039283 Rosetta Predictions human pricing
NM_001108917 Rosetta Predictions rat pricing
NM_026010 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_370636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273604 predicted 1311
2 SASI_Hs01_00273605 predicted 880
3 SASI_Hs01_00273606 predicted 1172
4 SASI_Hs01_00273607 predicted 895
5 SASI_Hs01_00273608 predicted 1229
6 SASI_Hs01_00273609 predicted 1195
7 SASI_Hs01_00273610 predicted 946
8 SASI_Hs01_00273611 predicted 1066
9 SASI_Hs01_00273612 predicted 1258
10 SASI_Hs01_00273613 predicted 1216
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278183 predicted 1279
2 SASI_Hs01_00278184 predicted 1125
3 SASI_Hs01_00278185 predicted 854
4 SASI_Hs01_00278186 predicted 1183
5 SASI_Hs01_00278187 predicted 1159
6 SASI_Hs01_00278188 predicted 898
7 SASI_Hs01_00278189 predicted 1037
8 SASI_Hs01_00278190 predicted 1221
9 SASI_Hs01_00278191 predicted 1173
10 SASI_Hs01_00278192 predicted 1212
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00509440 predicted 1497
2 SASI_Hs02_00509441 predicted 1350
3 SASI_Hs02_00509442 predicted 1070
4 SASI_Hs02_00509443 predicted 1406
5 SASI_Hs02_00509444 predicted 1375
6 SASI_Hs02_00509445 predicted 1124
7 SASI_Hs02_00509446 predicted 1254
8 SASI_Hs02_00509447 predicted 1395
9 SASI_Hs02_00509448 predicted 1424
10 SASI_Hs02_00509449 predicted 1397
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039136 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00509539 predicted 1494
2 SASI_Hs02_00509540 predicted 1344
3 SASI_Hs02_00509541 predicted 1077
4 SASI_Hs02_00509542 predicted 1405
5 SASI_Hs02_00509543 predicted 1370
6 SASI_Hs02_00509544 predicted 1117
7 SASI_Hs02_00509545 predicted 1249
8 SASI_Hs02_00509546 predicted 1435
9 SASI_Hs02_00509547 predicted 1393
10 SASI_Hs02_00509548 predicted 1429
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00510312 predicted 1488
2 SASI_Hs02_00510313 predicted 1341
3 SASI_Hs02_00510314 predicted 1076
4 SASI_Hs02_00510315 predicted 1400
5 SASI_Hs02_00510316 predicted 1369
6 SASI_Hs02_00510317 predicted 1117
7 SASI_Hs02_00510318 predicted 1246
8 SASI_Hs02_00510319 predicted 1392
9 SASI_Hs02_00510320 predicted 1427
10 SASI_Hs02_00510321 predicted 1394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108917 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243364 predicted 762
2 SASI_Rn02_00243365 predicted 757
3 SASI_Rn02_00243366 predicted 655
4 SASI_Rn02_00243367 predicted 417
5 SASI_Rn02_00243368 predicted 487
6 SASI_Rn02_00243369 predicted 760
7 SASI_Rn02_00243370 predicted 808
8 SASI_Rn02_00243371 predicted 585
9 SASI_Rn02_00243372 predicted 572
10 SASI_Rn02_00243373 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026010 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151550 predicted 822
2 SASI_Mm01_00151551 predicted 587
3 SASI_Mm01_00151552 predicted 848
4 SASI_Mm01_00151553 predicted 630
5 SASI_Mm01_00151554 predicted 692
6 SASI_Mm01_00151555 predicted 652
7 SASI_Mm01_00151556 predicted 510
8 SASI_Mm01_00151557 predicted 896
9 SASI_Mm02_00329476 predicted 740
10 SASI_Mm01_00151558 predicted 642
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026010
LIPT2 MISSION shRNA Bacterial Glycerol Stock
lipoyl(octanoyl) transferase 2 (putative)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026010.1-1160s1c1
Sequence:CCGGCCTGGGTCTTTCTTCAGTAAACTCGAGTTTACTGAAGAAAGACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026010.1-632s1c1
Sequence:CCGGGCCATCATTCCTTGTGGCATTCTCGAGAATGCCACAAGGAATGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026010.1-66s1c1
Sequence:CCGGGCGTTGCAGGAGCATTGGCTACTCGAGTAGCCAATGCTCCTGCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026010.1-603s1c1
Sequence:CCGGCAAAGACTTGTCACTGTGGATCTCGAGATCCACAGTGACAAGTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-310s21c1
Sequence:CCGGTGCTTGACTTGCGGCTCCTAGCTCGAGCTAGGAGCCGCAAGTCAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026010.2-981s21c1
Sequence:CCGGGAGACACTCCAGTGTTATTATCTCGAGATAATAACACTGGAGTGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-523s21c1
Sequence:CCGGCAACCGACCTCACATGGTTTGCTCGAGCAAACCATGTGAGGTCGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-633s21c1
Sequence:CCGGCCATCATTCCTTGTGGCATTCCTCGAGGAATGCCACAAGGAATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026010.2-895s21c1
Sequence:CCGGCACCTACCTCAGACGACATTACTCGAGTAATGTCGTCTGAGGTAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-694s21c1
Sequence:CCGGCCAGCTGAAGGACATTCATTCCTCGAGGAATGAATGTCCTTCAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-659s21c1
Sequence:CCGGGACTTTCAAGTGCACGTTAATCTCGAGATTAACGTGCACTTGAAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-478s21c1
Sequence:CCGGGCTGTGGAAGACACATCACGTCTCGAGACGTGATGTGTCTTCCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-565s21c1
Sequence:CCGGTGGTTGGAACTGGAGTCACTTCTCGAGAAGTGACTCCAGTTCCAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026010
LIPT2 MISSION shRNA shRNA Plasmid DNA
lipoyl(octanoyl) transferase 2 (putative)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026010.1-1160s1c1
Sequence:CCGGCCTGGGTCTTTCTTCAGTAAACTCGAGTTTACTGAAGAAAGACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026010.1-632s1c1
Sequence:CCGGGCCATCATTCCTTGTGGCATTCTCGAGAATGCCACAAGGAATGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026010.1-66s1c1
Sequence:CCGGGCGTTGCAGGAGCATTGGCTACTCGAGTAGCCAATGCTCCTGCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026010.1-603s1c1
Sequence:CCGGCAAAGACTTGTCACTGTGGATCTCGAGATCCACAGTGACAAGTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-310s21c1
Sequence:CCGGTGCTTGACTTGCGGCTCCTAGCTCGAGCTAGGAGCCGCAAGTCAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026010.2-981s21c1
Sequence:CCGGGAGACACTCCAGTGTTATTATCTCGAGATAATAACACTGGAGTGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-523s21c1
Sequence:CCGGCAACCGACCTCACATGGTTTGCTCGAGCAAACCATGTGAGGTCGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-633s21c1
Sequence:CCGGCCATCATTCCTTGTGGCATTCCTCGAGGAATGCCACAAGGAATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026010.2-895s21c1
Sequence:CCGGCACCTACCTCAGACGACATTACTCGAGTAATGTCGTCTGAGGTAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-694s21c1
Sequence:CCGGCCAGCTGAAGGACATTCATTCCTCGAGGAATGAATGTCCTTCAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-659s21c1
Sequence:CCGGGACTTTCAAGTGCACGTTAATCTCGAGATTAACGTGCACTTGAAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-478s21c1
Sequence:CCGGGCTGTGGAAGACACATCACGTCTCGAGACGTGATGTGTCTTCCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-565s21c1
Sequence:CCGGTGGTTGGAACTGGAGTCACTTCTCGAGAAGTGACTCCAGTTCCAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026010
LIPT2 MISSION shRNA Lentiviral Transduction Particles
lipoyl(octanoyl) transferase 2 (putative)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026010.1-1160s1c1
Sequence:CCGGCCTGGGTCTTTCTTCAGTAAACTCGAGTTTACTGAAGAAAGACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026010.1-632s1c1
Sequence:CCGGGCCATCATTCCTTGTGGCATTCTCGAGAATGCCACAAGGAATGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026010.1-66s1c1
Sequence:CCGGGCGTTGCAGGAGCATTGGCTACTCGAGTAGCCAATGCTCCTGCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026010.1-603s1c1
Sequence:CCGGCAAAGACTTGTCACTGTGGATCTCGAGATCCACAGTGACAAGTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-310s21c1
Sequence:CCGGTGCTTGACTTGCGGCTCCTAGCTCGAGCTAGGAGCCGCAAGTCAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026010.2-981s21c1
Sequence:CCGGGAGACACTCCAGTGTTATTATCTCGAGATAATAACACTGGAGTGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-523s21c1
Sequence:CCGGCAACCGACCTCACATGGTTTGCTCGAGCAAACCATGTGAGGTCGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-633s21c1
Sequence:CCGGCCATCATTCCTTGTGGCATTCCTCGAGGAATGCCACAAGGAATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026010.2-895s21c1
Sequence:CCGGCACCTACCTCAGACGACATTACTCGAGTAATGTCGTCTGAGGTAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-694s21c1
Sequence:CCGGCCAGCTGAAGGACATTCATTCCTCGAGGAATGAATGTCCTTCAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-659s21c1
Sequence:CCGGGACTTTCAAGTGCACGTTAATCTCGAGATTAACGTGCACTTGAAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-478s21c1
Sequence:CCGGGCTGTGGAAGACACATCACGTCTCGAGACGTGATGTGTCTTCCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026010.2-565s21c1
Sequence:CCGGTGGTTGGAACTGGAGTCACTTCTCGAGAAGTGACTCCAGTTCCAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001144869
LIPT2 MISSION shRNA Bacterial Glycerol Stock
lipoyl(octanoyl) transferase 2 (putative)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144869.1-444s21c1
Sequence:CCGGGGCTAGACGATCGCAAGATCTCTCGAGAGATCTTGCGATCGTCTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144869.1-696s21c1
Sequence:CCGGCCAACTGAAGAGTACTCATAACTCGAGTTATGAGTACTCTTCAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144869.1-763s21c1
Sequence:CCGGCACCTACTGAAACCCAGATTTCTCGAGAAATCTGGGTTTCAGTAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144869.1-637s21c1
Sequence:CCGGACCTTTCCTTGTGGCCTTTAACTCGAGTTAAAGGCCACAAGGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144869.1-524s21c1
Sequence:CCGGTCTACCGACCTCACGTGGTTTCTCGAGAAACCACGTGAGGTCGGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001144869
LIPT2 MISSION shRNA shRNA Plasmid DNA
lipoyl(octanoyl) transferase 2 (putative)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144869.1-444s21c1
Sequence:CCGGGGCTAGACGATCGCAAGATCTCTCGAGAGATCTTGCGATCGTCTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144869.1-696s21c1
Sequence:CCGGCCAACTGAAGAGTACTCATAACTCGAGTTATGAGTACTCTTCAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144869.1-763s21c1
Sequence:CCGGCACCTACTGAAACCCAGATTTCTCGAGAAATCTGGGTTTCAGTAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144869.1-637s21c1
Sequence:CCGGACCTTTCCTTGTGGCCTTTAACTCGAGTTAAAGGCCACAAGGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144869.1-524s21c1
Sequence:CCGGTCTACCGACCTCACGTGGTTTCTCGAGAAACCACGTGAGGTCGGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001144869
LIPT2 MISSION shRNA Lentiviral Transduction Particles
lipoyl(octanoyl) transferase 2 (putative)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144869.1-444s21c1
Sequence:CCGGGGCTAGACGATCGCAAGATCTCTCGAGAGATCTTGCGATCGTCTAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144869.1-696s21c1
Sequence:CCGGCCAACTGAAGAGTACTCATAACTCGAGTTATGAGTACTCTTCAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144869.1-763s21c1
Sequence:CCGGCACCTACTGAAACCCAGATTTCTCGAGAAATCTGGGTTTCAGTAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144869.1-637s21c1
Sequence:CCGGACCTTTCCTTGTGGCCTTTAACTCGAGTTAAAGGCCACAAGGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144869.1-524s21c1
Sequence:CCGGTCTACCGACCTCACGTGGTTTCTCGAGAAACCACGTGAGGTCGGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)