EMAIL THIS PAGE TO A FRIEND

LITAF

lipopolysaccharide-induced TNF factor

126 Gene Product Result for
Synonyms: PIG7 SIMPLE TP53I7
UniProtKB ID: Q99732, D3DUG1, G5E9K0, Q05DW0, Q9C0L6
Gene ID:
Human(9516) Summary: Lipopolysaccharide is a potent stimulator of monocytes and macrophages, causing secretion of tumor necrosis factor-alpha (TNF-alpha) and other inflammatory mediators. This gene encodes lipopolysaccharide-induced TNF-alpha factor, which is a DNA-binding protein and can mediate the TNF-alpha expression by direct binding to the promoter region of the TNF-alpha gene. The transcription of this gene is induced by tumor suppresor p53 and has been implicated in the p53-induced apoptotic pathway. Mutations in this gene cause Charcot-Marie-Tooth disease type 1C (CMT1C) and may be involved in the carcinogenesis of extramammary Paget's disease (EMPD). Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2008]
Mouse(56722) LPS-induced TN factor
Rat(65161) lipopolysaccharide-induced TNF factor
Zebrafish(431731) lipopolysaccharide-induced TNF factor
Horse(100033923) lipopolysaccharide-induced TNF factor
cow(520564) lipopolysaccharide-induced TNF factor
domestic cat(101083562) lipopolysaccharide-induced TNF factor
chicken(374125) lipopolysaccharide-induced TNF factor
dog(490004) lipopolysaccharide-induced TNF factor
sheep(101109408) lipopolysaccharide-induced TNF factor
domestic guinea pig(100729493) lipopolysaccharide-induced TNF factor
naked mole-rat(101725320) lipopolysaccharide-induced TNF factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
R6520 Rolipram solid, ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004862 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004862 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004862 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019980 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019980 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019980 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004862 Rosetta Predictions human pricing
NM_001105735 Rosetta Predictions rat pricing
NM_019980 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236531 predicted 982
2 SASI_Hs01_00236532 predicted 388
3 SASI_Hs01_00236534 predicted 678
4 SASI_Hs01_00236535 predicted 538
5 SASI_Hs01_00236536 predicted 971
6 SASI_Hs02_00338474 predicted 827
7 SASI_Hs01_00236537 predicted 1006
8 SASI_Hs02_00338475 predicted 897
9 SASI_Hs01_00236540 predicted 661
10 SASI_Hs02_00338476 predicted 441
11 SASI_Hs01_00236533 predicted 309
12 SASI_Hs01_00236538 predicted 699
13 SASI_Hs01_00236539 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105735 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212016 predicted 975
2 SASI_Rn02_00212017 predicted 576
3 SASI_Rn02_00212018 predicted 700
4 SASI_Rn02_00212019 predicted 919
5 SASI_Rn02_00212020 predicted 670
6 SASI_Rn02_00212021 predicted 978
7 SASI_Rn02_00212022 predicted 482
8 SASI_Rn02_00212023 predicted 969
9 SASI_Rn02_00212024 predicted 710
10 SASI_Rn02_00212025 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019980 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056897 predicted 516
2 SASI_Mm01_00056898 predicted 738
3 SASI_Mm01_00056900 predicted 464
4 SASI_Mm01_00056901 predicted 206
5 SASI_Mm01_00056902 predicted 261
6 SASI_Mm01_00056903 predicted 406
7 SASI_Mm01_00056905 predicted 567
8 SASI_Mm01_00056906 predicted 605
9 SASI_Mm02_00325302 predicted 617
10 SASI_Mm02_00325303 predicted 200
11 SASI_Mm01_00056899 predicted 463
12 SASI_Mm01_00056904 predicted 737
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004862
VALIDATED
LITAF MISSION shRNA Bacterial Glycerol Stock
lipopolysaccharide-induced TNF factor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004862.3-397s21c1
Sequence:CCGGGCATGAATCCTCCTTCGTATTCTCGAGAATACGAAGGAGGATTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004862.1-291s1c1
Sequence:CCGGCCTCCATCCTATGAAGAGACACTCGAGTGTCTCTTCATAGGATGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004862.1-397s1c1
Sequence:CCGGGCATGAATCCTCCTTCGTATTCTCGAGAATACGAAGGAGGATTCATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004862.1-515s1c1
Sequence:CCGGGTGTTGTCCTTCCTGCAACAACTCGAGTTGTTGCAGGAAGGACAACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004862.1-831s1c1
Sequence:CCGGGCCCACCTTCATGTCTTCTTTCTCGAGAAAGAAGACATGAAGGTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004862.1-1266s1c1
Sequence:CCGGGCACACAGATTCACTTTAATTCTCGAGAATTAAAGTGAATCTGTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004862.3-830s21c1
Sequence:CCGGGCCCACCTTCATGTCTTCTTTCTCGAGAAAGAAGACATGAAGGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004862.3-515s21c1
Sequence:CCGGGTGTTGTCCTTCCTGCAACAACTCGAGTTGTTGCAGGAAGGACAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004862.3-1265s21c1
Sequence:CCGGGCACACAGATTCACTTTAATTCTCGAGAATTAAAGTGAATCTGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004862
VALIDATED
LITAF MISSION shRNA shRNA Plasmid DNA
lipopolysaccharide-induced TNF factor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004862.3-397s21c1
Sequence:CCGGGCATGAATCCTCCTTCGTATTCTCGAGAATACGAAGGAGGATTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004862.1-291s1c1
Sequence:CCGGCCTCCATCCTATGAAGAGACACTCGAGTGTCTCTTCATAGGATGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004862.1-397s1c1
Sequence:CCGGGCATGAATCCTCCTTCGTATTCTCGAGAATACGAAGGAGGATTCATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004862.1-515s1c1
Sequence:CCGGGTGTTGTCCTTCCTGCAACAACTCGAGTTGTTGCAGGAAGGACAACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004862.1-831s1c1
Sequence:CCGGGCCCACCTTCATGTCTTCTTTCTCGAGAAAGAAGACATGAAGGTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004862.1-1266s1c1
Sequence:CCGGGCACACAGATTCACTTTAATTCTCGAGAATTAAAGTGAATCTGTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004862.3-830s21c1
Sequence:CCGGGCCCACCTTCATGTCTTCTTTCTCGAGAAAGAAGACATGAAGGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004862.3-515s21c1
Sequence:CCGGGTGTTGTCCTTCCTGCAACAACTCGAGTTGTTGCAGGAAGGACAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004862.3-1265s21c1
Sequence:CCGGGCACACAGATTCACTTTAATTCTCGAGAATTAAAGTGAATCTGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004862
VALIDATED
LITAF MISSION shRNA Lentiviral Transduction Particles
lipopolysaccharide-induced TNF factor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004862.3-397s21c1
Sequence:CCGGGCATGAATCCTCCTTCGTATTCTCGAGAATACGAAGGAGGATTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004862.1-291s1c1
Sequence:CCGGCCTCCATCCTATGAAGAGACACTCGAGTGTCTCTTCATAGGATGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004862.1-397s1c1
Sequence:CCGGGCATGAATCCTCCTTCGTATTCTCGAGAATACGAAGGAGGATTCATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004862.1-515s1c1
Sequence:CCGGGTGTTGTCCTTCCTGCAACAACTCGAGTTGTTGCAGGAAGGACAACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004862.1-831s1c1
Sequence:CCGGGCCCACCTTCATGTCTTCTTTCTCGAGAAAGAAGACATGAAGGTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004862.1-1266s1c1
Sequence:CCGGGCACACAGATTCACTTTAATTCTCGAGAATTAAAGTGAATCTGTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004862.3-830s21c1
Sequence:CCGGGCCCACCTTCATGTCTTCTTTCTCGAGAAAGAAGACATGAAGGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004862.3-515s21c1
Sequence:CCGGGTGTTGTCCTTCCTGCAACAACTCGAGTTGTTGCAGGAAGGACAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297834    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004862.3-1265s21c1
Sequence:CCGGGCACACAGATTCACTTTAATTCTCGAGAATTAAAGTGAATCTGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019980
VALIDATED
LITAF MISSION shRNA Bacterial Glycerol Stock
lipopolysaccharide-induced TNF factor
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019980.1-881s21c1
Sequence:CCGGCACTGTTTGGCTTGATCTATTCTCGAGAATAGATCAAGCCAAACAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019980.1-270s21c1
Sequence:CCGGTTGCCGTGCAGACCGTTTATGCTCGAGCATAAACGGTCTGCACGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019980.1-132s1c1
Sequence:CCGGGTGTCAACAGTTACTACCCAACTCGAGTTGGGTAGTAACTGTTGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019980.1-269s1c1
Sequence:CCGGATTGCCGTGCAGACCGTTTATCTCGAGATAAACGGTCTGCACGGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019980.1-408s1c1
Sequence:CCGGGCAGTCTGTGTCTGCTGGGATCTCGAGATCCCAGCAGACACAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019980.1-468s1c1
Sequence:CCGGCCCTACAGGATGTGGACCACTCTCGAGAGTGGTCCACATCCTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019980.1-115s1c1
Sequence:CCGGCTATGAAGAAACAGTGGGTGTCTCGAGACACCCACTGTTTCTTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019980.1-201s21c1
Sequence:CCGGCAGATGGGAAGGGAATGAATCCTCGAGGATTCATTCCCTTCCCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019980.2-301s21c1
Sequence:CCGGATTGCCGTGCAGACCGTTTATCTCGAGATAAACGGTCTGCACGGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019980.1-360s21c1
Sequence:CCGGTGACCCAGCTGTCCTACAATGCTCGAGCATTGTAGGACAGCTGGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019980.1-294s21c1
Sequence:CCGGAGCAGCCTGTCTCCTTCTATGCTCGAGCATAGAAGGAGACAGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019980
VALIDATED
LITAF MISSION shRNA shRNA Plasmid DNA
lipopolysaccharide-induced TNF factor
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019980.1-881s21c1
Sequence:CCGGCACTGTTTGGCTTGATCTATTCTCGAGAATAGATCAAGCCAAACAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019980.1-270s21c1
Sequence:CCGGTTGCCGTGCAGACCGTTTATGCTCGAGCATAAACGGTCTGCACGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019980.1-132s1c1
Sequence:CCGGGTGTCAACAGTTACTACCCAACTCGAGTTGGGTAGTAACTGTTGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019980.1-269s1c1
Sequence:CCGGATTGCCGTGCAGACCGTTTATCTCGAGATAAACGGTCTGCACGGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019980.1-408s1c1
Sequence:CCGGGCAGTCTGTGTCTGCTGGGATCTCGAGATCCCAGCAGACACAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019980.1-468s1c1
Sequence:CCGGCCCTACAGGATGTGGACCACTCTCGAGAGTGGTCCACATCCTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019980.1-115s1c1
Sequence:CCGGCTATGAAGAAACAGTGGGTGTCTCGAGACACCCACTGTTTCTTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019980.1-201s21c1
Sequence:CCGGCAGATGGGAAGGGAATGAATCCTCGAGGATTCATTCCCTTCCCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019980.2-301s21c1
Sequence:CCGGATTGCCGTGCAGACCGTTTATCTCGAGATAAACGGTCTGCACGGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019980.1-360s21c1
Sequence:CCGGTGACCCAGCTGTCCTACAATGCTCGAGCATTGTAGGACAGCTGGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019980.1-294s21c1
Sequence:CCGGAGCAGCCTGTCTCCTTCTATGCTCGAGCATAGAAGGAGACAGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019980
VALIDATED
LITAF MISSION shRNA Lentiviral Transduction Particles
lipopolysaccharide-induced TNF factor
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019980.1-881s21c1
Sequence:CCGGCACTGTTTGGCTTGATCTATTCTCGAGAATAGATCAAGCCAAACAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019980.1-270s21c1
Sequence:CCGGTTGCCGTGCAGACCGTTTATGCTCGAGCATAAACGGTCTGCACGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019980.1-132s1c1
Sequence:CCGGGTGTCAACAGTTACTACCCAACTCGAGTTGGGTAGTAACTGTTGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019980.1-269s1c1
Sequence:CCGGATTGCCGTGCAGACCGTTTATCTCGAGATAAACGGTCTGCACGGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019980.1-408s1c1
Sequence:CCGGGCAGTCTGTGTCTGCTGGGATCTCGAGATCCCAGCAGACACAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019980.1-468s1c1
Sequence:CCGGCCCTACAGGATGTGGACCACTCTCGAGAGTGGTCCACATCCTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019980.1-115s1c1
Sequence:CCGGCTATGAAGAAACAGTGGGTGTCTCGAGACACCCACTGTTTCTTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019980.1-201s21c1
Sequence:CCGGCAGATGGGAAGGGAATGAATCCTCGAGGATTCATTCCCTTCCCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019980.2-301s21c1
Sequence:CCGGATTGCCGTGCAGACCGTTTATCTCGAGATAAACGGTCTGCACGGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019980.1-360s21c1
Sequence:CCGGTGACCCAGCTGTCCTACAATGCTCGAGCATTGTAGGACAGCTGGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019980.1-294s21c1
Sequence:CCGGAGCAGCCTGTCTCCTTCTATGCTCGAGCATAGAAGGAGACAGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)