EMAIL THIS PAGE TO A FRIEND

LLPH

LLP homolog, long-term synaptic facilitation (Aplysia)

55 Gene Product Result for
Synonyms: C12orf31 hLLP
UniProtKB ID: Q9BRT6, Q3B766
Gene ID:
Mouse(66225) LLP homolog, long-term synaptic facilitation (Aplysia)
Rat(299818) LLP homolog, long-term synaptic facilitation (Aplysia)
chicken(771027) LLP homolog, long-term synaptic facilitation (Aplysia)
cow(510518) LLP homolog, long-term synaptic facilitation (Aplysia)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025431 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025431 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025431 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032338 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032338 Rosetta Predictions human pricing
NM_001134464 Rosetta Predictions rat pricing
XM_216898 Rosetta Predictions rat pricing
NM_025431 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037249 predicted 641
2 SASI_Hs01_00037250 predicted 634
3 SASI_Hs01_00037251 predicted 726
4 SASI_Hs01_00037253 predicted 641
5 SASI_Hs01_00037255 predicted 684
6 SASI_Hs01_00037256 predicted 701
7 SASI_Hs01_00037257 predicted 712
8 SASI_Hs01_00037258 predicted 672
9 SASI_Hs02_00359721 predicted 698
10 SASI_Hs01_00037252 predicted 739
11 SASI_Hs01_00037254 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134464 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256379 predicted 279
2 SASI_Rn02_00256380 predicted 750
3 SASI_Rn02_00256381 predicted 810
4 SASI_Rn02_00256382 predicted 770
5 SASI_Rn02_00256383 predicted 774
6 SASI_Rn02_00256384 predicted 758
7 SASI_Rn02_00256385 predicted 282
8 SASI_Rn02_00256386 predicted 774
9 SASI_Rn02_00256387 predicted 770
10 SASI_Rn02_00256388 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216898 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00135312 predicted 959
2 SASI_Rn01_00135313 predicted 477
3 SASI_Rn01_00135314 predicted 990
4 SASI_Rn01_00135315 predicted 979
5 SASI_Rn01_00135316 predicted 1008
6 SASI_Rn01_00135317 predicted 320
7 SASI_Rn01_00135318 predicted 985
8 SASI_Rn01_00135319 predicted 278
9 SASI_Rn01_00135320 predicted 352
10 SASI_Rn01_00135321 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025431 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181025 predicted 929
2 SASI_Mm01_00181026 predicted 845
3 SASI_Mm01_00181027 predicted 811
4 SASI_Mm01_00181028 predicted 862
5 SASI_Mm01_00181029 predicted 853
6 SASI_Mm01_00181030 predicted 749
7 SASI_Mm01_00181031 predicted 321
8 SASI_Mm01_00181032 predicted 811
9 SASI_Mm01_00181033 predicted 806
10 SASI_Mm01_00181034 predicted 892
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025431
VALIDATED
LLPH MISSION shRNA Bacterial Glycerol Stock
LLP homolog, long-term synaptic facilitation (Aplysia)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025431.2-325s1c1
Sequence:CCGGGAAACAGAAAGACTCTTCTAGCTCGAGCTAGAAGAGTCTTTCTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025431.2-114s1c1
Sequence:CCGGGCCGAGAAGAGAAAGAAGAATCTCGAGATTCTTCTTTCTCTTCTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025431.2-394s1c1
Sequence:CCGGGACTGAAGGCCAAGAGAGAAACTCGAGTTTCTCTCTTGGCCTTCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025431.2-186s1c1
Sequence:CCGGGCTCTAATGAAAGACGTTGAGCTCGAGCTCAACGTCTTTCATTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025431.2-371s1c1
Sequence:CCGGGATGAACCAGAGGCAAAGAAACTCGAGTTTCTTTGCCTCTGGTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025431.2-325s21c1
Sequence:CCGGGAAACAGAAAGACTCTTCTAGCTCGAGCTAGAAGAGTCTTTCTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025431.2-114s21c1
Sequence:CCGGGCCGAGAAGAGAAAGAAGAATCTCGAGATTCTTCTTTCTCTTCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025431.2-186s21c1
Sequence:CCGGGCTCTAATGAAAGACGTTGAGCTCGAGCTCAACGTCTTTCATTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025431
VALIDATED
LLPH MISSION shRNA shRNA Plasmid DNA
LLP homolog, long-term synaptic facilitation (Aplysia)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025431.2-325s1c1
Sequence:CCGGGAAACAGAAAGACTCTTCTAGCTCGAGCTAGAAGAGTCTTTCTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025431.2-114s1c1
Sequence:CCGGGCCGAGAAGAGAAAGAAGAATCTCGAGATTCTTCTTTCTCTTCTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025431.2-394s1c1
Sequence:CCGGGACTGAAGGCCAAGAGAGAAACTCGAGTTTCTCTCTTGGCCTTCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025431.2-186s1c1
Sequence:CCGGGCTCTAATGAAAGACGTTGAGCTCGAGCTCAACGTCTTTCATTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025431.2-371s1c1
Sequence:CCGGGATGAACCAGAGGCAAAGAAACTCGAGTTTCTTTGCCTCTGGTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025431.2-325s21c1
Sequence:CCGGGAAACAGAAAGACTCTTCTAGCTCGAGCTAGAAGAGTCTTTCTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025431.2-114s21c1
Sequence:CCGGGCCGAGAAGAGAAAGAAGAATCTCGAGATTCTTCTTTCTCTTCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025431.2-186s21c1
Sequence:CCGGGCTCTAATGAAAGACGTTGAGCTCGAGCTCAACGTCTTTCATTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025431
VALIDATED
LLPH MISSION shRNA Lentiviral Transduction Particles
LLP homolog, long-term synaptic facilitation (Aplysia)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025431.2-325s1c1
Sequence:CCGGGAAACAGAAAGACTCTTCTAGCTCGAGCTAGAAGAGTCTTTCTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025431.2-114s1c1
Sequence:CCGGGCCGAGAAGAGAAAGAAGAATCTCGAGATTCTTCTTTCTCTTCTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025431.2-394s1c1
Sequence:CCGGGACTGAAGGCCAAGAGAGAAACTCGAGTTTCTCTCTTGGCCTTCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025431.2-186s1c1
Sequence:CCGGGCTCTAATGAAAGACGTTGAGCTCGAGCTCAACGTCTTTCATTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025431.2-371s1c1
Sequence:CCGGGATGAACCAGAGGCAAAGAAACTCGAGTTTCTTTGCCTCTGGTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025431.2-325s21c1
Sequence:CCGGGAAACAGAAAGACTCTTCTAGCTCGAGCTAGAAGAGTCTTTCTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025431.2-114s21c1
Sequence:CCGGGCCGAGAAGAGAAAGAAGAATCTCGAGATTCTTCTTTCTCTTCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025431.2-186s21c1
Sequence:CCGGGCTCTAATGAAAGACGTTGAGCTCGAGCTCAACGTCTTTCATTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032338
VALIDATED
LLPH MISSION shRNA Bacterial Glycerol Stock
LLP homolog, long-term synaptic facilitation (Aplysia)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173100    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032338.2-587s1c1
Sequence:CCGGCCCAGCATAACTCCTCAAGTTCTCGAGAACTTGAGGAGTTATGCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032338.2-192s1c1
Sequence:CCGGGAGATAGCAACTGTGGTGGTACTCGAGTACCACCACAGTTGCTATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032338.2-148s1c1
Sequence:CCGGGTATTCTCAAACTAGACGGTGCTCGAGCACCGTCTAGTTTGAGAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032338.2-219s1c1
Sequence:CCGGCCCAAACATTGCCAAGAGAAACTCGAGTTTCTCTTGGCAATGTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032338.3-739s21c1
Sequence:CCGGGTTCTTACAACTGGTAATTATCTCGAGATAATTACCAGTTGTAAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032338.3-705s21c1
Sequence:CCGGCAACGTTCTGTCAGGTATTAACTCGAGTTAATACCTGACAGAACGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032338.3-647s21c1
Sequence:CCGGCCAAGCTCTACTGATACTTTACTCGAGTAAAGTATCAGTAGAGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032338
VALIDATED
LLPH MISSION shRNA shRNA Plasmid DNA
LLP homolog, long-term synaptic facilitation (Aplysia)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173100    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032338.2-587s1c1
Sequence:CCGGCCCAGCATAACTCCTCAAGTTCTCGAGAACTTGAGGAGTTATGCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032338.2-192s1c1
Sequence:CCGGGAGATAGCAACTGTGGTGGTACTCGAGTACCACCACAGTTGCTATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032338.2-148s1c1
Sequence:CCGGGTATTCTCAAACTAGACGGTGCTCGAGCACCGTCTAGTTTGAGAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032338.2-219s1c1
Sequence:CCGGCCCAAACATTGCCAAGAGAAACTCGAGTTTCTCTTGGCAATGTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032338.3-739s21c1
Sequence:CCGGGTTCTTACAACTGGTAATTATCTCGAGATAATTACCAGTTGTAAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032338.3-705s21c1
Sequence:CCGGCAACGTTCTGTCAGGTATTAACTCGAGTTAATACCTGACAGAACGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032338.3-647s21c1
Sequence:CCGGCCAAGCTCTACTGATACTTTACTCGAGTAAAGTATCAGTAGAGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032338
VALIDATED
LLPH MISSION shRNA Lentiviral Transduction Particles
LLP homolog, long-term synaptic facilitation (Aplysia)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173100    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032338.2-587s1c1
Sequence:CCGGCCCAGCATAACTCCTCAAGTTCTCGAGAACTTGAGGAGTTATGCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032338.2-192s1c1
Sequence:CCGGGAGATAGCAACTGTGGTGGTACTCGAGTACCACCACAGTTGCTATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032338.2-148s1c1
Sequence:CCGGGTATTCTCAAACTAGACGGTGCTCGAGCACCGTCTAGTTTGAGAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032338.2-219s1c1
Sequence:CCGGCCCAAACATTGCCAAGAGAAACTCGAGTTTCTCTTGGCAATGTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032338.3-739s21c1
Sequence:CCGGGTTCTTACAACTGGTAATTATCTCGAGATAATTACCAGTTGTAAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032338.3-705s21c1
Sequence:CCGGCAACGTTCTGTCAGGTATTAACTCGAGTTAATACCTGACAGAACGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032338.3-647s21c1
Sequence:CCGGCCAAGCTCTACTGATACTTTACTCGAGTAAAGTATCAGTAGAGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)