EMAIL THIS PAGE TO A FRIEND

LMAN1

lectin, mannose-binding, 1

81 Gene Product Result for
Synonyms: ERGIC-53 ERGIC53 F5F8D FMFD1 MCFD1 MR60 gp58
Gene ID:
Human(3998) Summary: The protein encoded by this gene is a type I integral membrane protein localized in the intermediate region between the endoplasmic reticulum and the Golgi, presumably recycling between the two compartments. The protein is a mannose-specific lectin and is a member of a novel family of plant lectin homologs in the secretory pathway of animal cells. Mutations in the gene are associated with a coagulation defect. Using positional cloning, the gene was identified as the disease gene leading to combined factor V-factor VIII deficiency, a rare, autosomal recessive disorder in which both coagulation factors V and VIII are diminished. [provided by RefSeq, Jul 2008]
Mouse(70361) lectin, mannose-binding, 1
Rat(116666) lectin, mannose-binding, 1
Zebrafish(559775) lectin, mannose-binding, 1
chicken(426849) lectin, mannose-binding, 1
cow(511649) lectin, mannose-binding, 1
Horse(100050262) lectin, mannose-binding, 1
domestic cat(101080833) lectin, mannose-binding, 1
dog(476186) lectin, mannose-binding, 1
sheep(101117293) lectin, mannose-binding, 1
Domestic Rabbit(100354112) lectin, mannose-binding, 1
domestic guinea pig(100728262) lectin, mannose-binding, 1
naked mole-rat(101723407) lectin, mannose-binding, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
E1031 Anti-ERGIC-53/p58 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
immunofluorescence, western blot pricing
E6782 Anti-ERGIC-53/p58−Cy3 antibody produced in rabbit 1.5-3.0 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse
immunofluorescence pricing
GW21589A Anti-LMAN1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
HPA002320 Anti-LMAN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV46614 Anti-LMAN1 antibody produced in rabbit IgG fraction of antiserum human, rat, dog, mouse, rabbit
western blot pricing
SAB2101351 Anti-LMAN1 antibody produced in rabbit affinity isolated antibody pig, bovine, rat, dog, horse, human, mouse
western blot pricing
SAB4200585 Monoclonal Anti-ERGIC-53 antibody produced in mouse ~1.0 mg/mL, clone ERGIC-3, purified immunoglobulin human, mouse, rat
western blot pricing
SAB4100364 Monoclonal Anti-ERGIC53 antibody produced in mouse clone ERGIC53-A308, culture supernatant human
western blot pricing
SAB4100365 Monoclonal Anti-ERGIC53 antibody produced in mouse clone ERGIC53-B308, culture supernatant human
western blot pricing
SAB4100366 Monoclonal Anti-ERGIC53 antibody produced in mouse clone ERGIC53-C308, culture supernatant human
western blot pricing
SAB4100203 Monoclonal Anti-LMAN1 antibody produced in mouse clone LMAN1 -A157, culture supernatant human
western blot pricing
SAB4100204 Monoclonal Anti-LMAN1 antibody produced in mouse clone LMAN1 -B157, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005570 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027400 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027400 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027400 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005570 Rosetta Predictions human pricing
NM_053886 Rosetta Predictions rat pricing
NM_027400 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189318 predicted 1333
2 SASI_Hs01_00189320 predicted 520
3 SASI_Hs01_00189322 predicted 1340
4 SASI_Hs01_00189323 predicted 633
5 SASI_Hs01_00189324 predicted 226
6 SASI_Hs01_00189325 predicted 655
7 SASI_Hs01_00189326 predicted 500
8 SASI_Hs01_00189327 predicted 619
9 SASI_Hs02_00339845 predicted 1381
10 SASI_Hs02_00339846 predicted 620
11 SASI_Hs01_00189319 predicted 1214
12 SASI_Hs01_00189321 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053886 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061543 predicted 642
2 SASI_Rn01_00061544 predicted 394
3 SASI_Rn01_00061546 predicted 512
4 SASI_Rn01_00061547 predicted 537
5 SASI_Rn01_00061548 predicted 520
6 SASI_Rn01_00061549 predicted 244
7 SASI_Rn01_00061550 predicted 785
8 SASI_Rn01_00061551 predicted 1463
9 SASI_Rn01_00061552 predicted 451
10 SASI_Rn02_00266805 predicted 635
11 SASI_Rn01_00061545 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086101 predicted 1631
2 SASI_Mm01_00086102 predicted 1668
3 SASI_Mm01_00086103 predicted 578
4 SASI_Mm01_00086105 predicted 522
5 SASI_Mm01_00086106 predicted 1034
6 SASI_Mm02_00332123 predicted 985
7 SASI_Mm01_00086107 predicted 536
8 SASI_Mm01_00086108 predicted 398
9 SASI_Mm01_00086109 predicted 449
10 SASI_Mm02_00332124 predicted 645
11 SASI_Mm01_00086104 predicted 441
12 SASI_Mm01_00086110 predicted 649
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005570
LMAN1 MISSION shRNA Bacterial Glycerol Stock
lectin, mannose-binding, 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005570.3-1933s21c1
Sequence:CCGGCCAGAATATGAGGTCTAATTACTCGAGTAATTAGACCTCATATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005570.3-388s21c1
Sequence:CCGGGAGCTGATGGCCTAGCAATTTCTCGAGAAATTGCTAGGCCATCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005570.2-1383s1c1
Sequence:CCGGCAGCGAAATATGCCATCAAATCTCGAGATTTGATGGCATATTTCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005570.2-158s1c1
Sequence:CCGGCGAGTACAAATACAGCTTCAACTCGAGTTGAAGCTGTATTTGTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005570.2-1349s1c1
Sequence:CCGGGCACATAGTAAAGAGGGACATCTCGAGATGTCCCTCTTTACTATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005570.2-841s1c1
Sequence:CCGGCGCCCACACCAGATAAAGAAACTCGAGTTTCTTTATCTGGTGTGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005570
LMAN1 MISSION shRNA shRNA Plasmid DNA
lectin, mannose-binding, 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005570.3-1933s21c1
Sequence:CCGGCCAGAATATGAGGTCTAATTACTCGAGTAATTAGACCTCATATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005570.3-388s21c1
Sequence:CCGGGAGCTGATGGCCTAGCAATTTCTCGAGAAATTGCTAGGCCATCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005570.2-1383s1c1
Sequence:CCGGCAGCGAAATATGCCATCAAATCTCGAGATTTGATGGCATATTTCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005570.2-158s1c1
Sequence:CCGGCGAGTACAAATACAGCTTCAACTCGAGTTGAAGCTGTATTTGTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005570.2-1349s1c1
Sequence:CCGGGCACATAGTAAAGAGGGACATCTCGAGATGTCCCTCTTTACTATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005570.2-841s1c1
Sequence:CCGGCGCCCACACCAGATAAAGAAACTCGAGTTTCTTTATCTGGTGTGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005570
LMAN1 MISSION shRNA Lentiviral Transduction Particles
lectin, mannose-binding, 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005570.3-1933s21c1
Sequence:CCGGCCAGAATATGAGGTCTAATTACTCGAGTAATTAGACCTCATATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005570.3-388s21c1
Sequence:CCGGGAGCTGATGGCCTAGCAATTTCTCGAGAAATTGCTAGGCCATCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005570.2-1383s1c1
Sequence:CCGGCAGCGAAATATGCCATCAAATCTCGAGATTTGATGGCATATTTCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005570.2-158s1c1
Sequence:CCGGCGAGTACAAATACAGCTTCAACTCGAGTTGAAGCTGTATTTGTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005570.2-1349s1c1
Sequence:CCGGGCACATAGTAAAGAGGGACATCTCGAGATGTCCCTCTTTACTATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005570.2-841s1c1
Sequence:CCGGCGCCCACACCAGATAAAGAAACTCGAGTTTCTTTATCTGGTGTGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027400
VALIDATED
LMAN1 MISSION shRNA Bacterial Glycerol Stock
lectin, mannose-binding, 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027400.2-166s21c1
Sequence:CCGGCCGCCGTTTCGAGTACAAATACTCGAGTATTTGTACTCGAAACGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027400.2-1034s21c1
Sequence:CCGGCAGGTGTTTGAAGGACAGAATCTCGAGATTCTGTCCTTCAAACACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027400.2-640s21c1
Sequence:CCGGCCGGGCAAAGATTACGTATTACTCGAGTAATACGTAATCTTTGCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027400.2-543s21c1
Sequence:CCGGGCAACAATGGACAAATCAATTCTCGAGAATTGATTTGTCCATTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027400.2-166s1c1
Sequence:CCGGCCGCCGTTTCGAGTACAAATACTCGAGTATTTGTACTCGAAACGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027400.2-811s21c1
Sequence:CCGGCGTTCTTTCTTTCCTGACTTTCTCGAGAAAGTCAGGAAAGAAAGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027400.2-811s1c1
Sequence:CCGGCGTTCTTTCTTTCCTGACTTTCTCGAGAAAGTCAGGAAAGAAAGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027400.2-640s1c1
Sequence:CCGGCCGGGCAAAGATTACGTATTACTCGAGTAATACGTAATCTTTGCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027400.2-1034s1c1
Sequence:CCGGCAGGTGTTTGAAGGACAGAATCTCGAGATTCTGTCCTTCAAACACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027400.2-543s1c1
Sequence:CCGGGCAACAATGGACAAATCAATTCTCGAGAATTGATTTGTCCATTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027400
VALIDATED
LMAN1 MISSION shRNA shRNA Plasmid DNA
lectin, mannose-binding, 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027400.2-166s21c1
Sequence:CCGGCCGCCGTTTCGAGTACAAATACTCGAGTATTTGTACTCGAAACGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027400.2-1034s21c1
Sequence:CCGGCAGGTGTTTGAAGGACAGAATCTCGAGATTCTGTCCTTCAAACACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027400.2-640s21c1
Sequence:CCGGCCGGGCAAAGATTACGTATTACTCGAGTAATACGTAATCTTTGCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027400.2-543s21c1
Sequence:CCGGGCAACAATGGACAAATCAATTCTCGAGAATTGATTTGTCCATTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027400.2-166s1c1
Sequence:CCGGCCGCCGTTTCGAGTACAAATACTCGAGTATTTGTACTCGAAACGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027400.2-811s21c1
Sequence:CCGGCGTTCTTTCTTTCCTGACTTTCTCGAGAAAGTCAGGAAAGAAAGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027400.2-811s1c1
Sequence:CCGGCGTTCTTTCTTTCCTGACTTTCTCGAGAAAGTCAGGAAAGAAAGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027400.2-640s1c1
Sequence:CCGGCCGGGCAAAGATTACGTATTACTCGAGTAATACGTAATCTTTGCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027400.2-1034s1c1
Sequence:CCGGCAGGTGTTTGAAGGACAGAATCTCGAGATTCTGTCCTTCAAACACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027400.2-543s1c1
Sequence:CCGGGCAACAATGGACAAATCAATTCTCGAGAATTGATTTGTCCATTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027400
VALIDATED
LMAN1 MISSION shRNA Lentiviral Transduction Particles
lectin, mannose-binding, 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027400.2-166s21c1
Sequence:CCGGCCGCCGTTTCGAGTACAAATACTCGAGTATTTGTACTCGAAACGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027400.2-1034s21c1
Sequence:CCGGCAGGTGTTTGAAGGACAGAATCTCGAGATTCTGTCCTTCAAACACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027400.2-640s21c1
Sequence:CCGGCCGGGCAAAGATTACGTATTACTCGAGTAATACGTAATCTTTGCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027400.2-543s21c1
Sequence:CCGGGCAACAATGGACAAATCAATTCTCGAGAATTGATTTGTCCATTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027400.2-166s1c1
Sequence:CCGGCCGCCGTTTCGAGTACAAATACTCGAGTATTTGTACTCGAAACGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027400.2-811s21c1
Sequence:CCGGCGTTCTTTCTTTCCTGACTTTCTCGAGAAAGTCAGGAAAGAAAGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027400.2-811s1c1
Sequence:CCGGCGTTCTTTCTTTCCTGACTTTCTCGAGAAAGTCAGGAAAGAAAGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027400.2-640s1c1
Sequence:CCGGCCGGGCAAAGATTACGTATTACTCGAGTAATACGTAATCTTTGCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027400.2-1034s1c1
Sequence:CCGGCAGGTGTTTGAAGGACAGAATCTCGAGATTCTGTCCTTCAAACACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027400.2-543s1c1
Sequence:CCGGGCAACAATGGACAAATCAATTCTCGAGAATTGATTTGTCCATTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)