EMAIL THIS PAGE TO A FRIEND

LMAN1L

lectin, mannose-binding, 1 like

62 Gene Product Result for
Synonyms: ERGIC-53L ERGL
UniProtKB ID: Q9HAT1, Q6UWN2
Gene ID:
Mouse(235416) lectin, mannose-binding 1 like
Rat(300743) lectin, mannose-binding, 1 like
domestic guinea pig(100714820) lectin, mannose-binding, 1 like
naked mole-rat(101712747) lectin, mannose-binding, 1 like
sheep(101108691) lectin, mannose-binding, 1 like
dog(487650) lectin, mannose-binding, 1 like
cow(617152) lectin, mannose-binding, 1 like
domestic cat(101085128) lectin, mannose-binding, 1 like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199222 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199222 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199222 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021819 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021819 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021819 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113291 MISSION® esiRNA esiRNA human LMAN1L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021819 Rosetta Predictions human pricing
NM_001012465 Rosetta Predictions rat pricing
NM_199222 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068829 predicted 1101
2 SASI_Hs01_00068830 predicted 1470
3 SASI_Hs01_00068832 predicted 1110
4 SASI_Hs01_00068833 predicted 206
5 SASI_Hs02_00355131 predicted 1463
6 SASI_Hs01_00068834 predicted 407
7 SASI_Hs01_00068835 predicted 1236
8 SASI_Hs01_00068836 predicted 522
9 SASI_Hs01_00068837 predicted 1252
10 SASI_Hs01_00068838 predicted 627
11 SASI_Hs01_00068831 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012465 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091807 predicted 1006
2 SASI_Rn01_00091808 predicted 378
3 SASI_Rn01_00091809 predicted 887
4 SASI_Rn01_00091810 predicted 622
5 SASI_Rn02_00200568 predicted 1134
6 SASI_Rn01_00091812 predicted 1187
7 SASI_Rn01_00091813 predicted 893
8 SASI_Rn01_00091814 predicted 545
9 SASI_Rn01_00091815 predicted 633
10 SASI_Rn01_00091816 predicted 435
11 SASI_Rn01_00091811 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199222 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190689 predicted 575
2 SASI_Mm01_00190690 predicted 495
3 SASI_Mm02_00351399 predicted 1388
4 SASI_Mm01_00190692 predicted 1013
5 SASI_Mm01_00190693 predicted 737
6 SASI_Mm01_00190695 predicted 847
7 SASI_Mm02_00351400 predicted 1416
8 SASI_Mm01_00190696 predicted 1035
9 SASI_Mm01_00190697 predicted 670
10 SASI_Mm01_00190698 predicted 278
11 SASI_Mm01_00190691 predicted 230
12 SASI_Mm01_00190694 predicted 1030
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199222
LMAN1L MISSION shRNA Bacterial Glycerol Stock
lectin, mannose-binding, 1 like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199222.1-516s1c1
Sequence:CCGGGCATCGGGATCTACTTTGATTCTCGAGAATCAAAGTAGATCCCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199222.1-1024s1c1
Sequence:CCGGAGAAGGTGAAAGGTTCTTTAACTCGAGTTAAAGAACCTTTCACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199222.1-905s1c1
Sequence:CCGGCAGCCATTCATGGAGAAGGATCTCGAGATCCTTCTCCATGAATGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199222.1-205s1c1
Sequence:CCGGTCGACGCAGGTTTGAGTACAACTCGAGTTGTACTCAAACCTGCGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199222.1-734s1c1
Sequence:CCGGCTTACTCCTAAGGACCCTGAACTCGAGTTCAGGGTCCTTAGGAGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199222
LMAN1L MISSION shRNA shRNA Plasmid DNA
lectin, mannose-binding, 1 like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199222.1-516s1c1
Sequence:CCGGGCATCGGGATCTACTTTGATTCTCGAGAATCAAAGTAGATCCCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199222.1-1024s1c1
Sequence:CCGGAGAAGGTGAAAGGTTCTTTAACTCGAGTTAAAGAACCTTTCACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199222.1-905s1c1
Sequence:CCGGCAGCCATTCATGGAGAAGGATCTCGAGATCCTTCTCCATGAATGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199222.1-205s1c1
Sequence:CCGGTCGACGCAGGTTTGAGTACAACTCGAGTTGTACTCAAACCTGCGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199222.1-734s1c1
Sequence:CCGGCTTACTCCTAAGGACCCTGAACTCGAGTTCAGGGTCCTTAGGAGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199222
LMAN1L MISSION shRNA Lentiviral Transduction Particles
lectin, mannose-binding, 1 like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199222.1-516s1c1
Sequence:CCGGGCATCGGGATCTACTTTGATTCTCGAGAATCAAAGTAGATCCCGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199222.1-1024s1c1
Sequence:CCGGAGAAGGTGAAAGGTTCTTTAACTCGAGTTAAAGAACCTTTCACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199222.1-905s1c1
Sequence:CCGGCAGCCATTCATGGAGAAGGATCTCGAGATCCTTCTCCATGAATGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199222.1-205s1c1
Sequence:CCGGTCGACGCAGGTTTGAGTACAACTCGAGTTGTACTCAAACCTGCGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199222.1-734s1c1
Sequence:CCGGCTTACTCCTAAGGACCCTGAACTCGAGTTCAGGGTCCTTAGGAGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021819
LMAN1L MISSION shRNA Bacterial Glycerol Stock
lectin, mannose-binding, 1 like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021819.1-138s1c1
Sequence:CCGGGAGTACAAGCTCAGCTTCAAACTCGAGTTTGAAGCTGAGCTTGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021819.1-1148s1c1
Sequence:CCGGCCTCTCCATGTCACTCAATAACTCGAGTTATTGAGTGACATGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021819.1-1285s1c1
Sequence:CCGGCTGTGGGCATTGAGCATCATTCTCGAGAATGATGCTCAATGCCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021819.1-306s1c1
Sequence:CCGGGCCTGGGAAGTAGAGGTGCAACTCGAGTTGCACCTCTACTTCCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021819.1-1448s1c1
Sequence:CCGGCCTCATTCAGACTGTAGGCTTCTCGAGAAGCCTACAGTCTGAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021819.2-562s21c1
Sequence:CCGGTCAGAGCACGGATCACCTACTCTCGAGAGTAGGTGATCCGTGCTCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021819.2-397s21c1
Sequence:CCGGACGGCATCGGGATCTTCTTTGCTCGAGCAAAGAAGATCCCGATGCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021819
LMAN1L MISSION shRNA shRNA Plasmid DNA
lectin, mannose-binding, 1 like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021819.1-138s1c1
Sequence:CCGGGAGTACAAGCTCAGCTTCAAACTCGAGTTTGAAGCTGAGCTTGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021819.1-1148s1c1
Sequence:CCGGCCTCTCCATGTCACTCAATAACTCGAGTTATTGAGTGACATGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021819.1-1285s1c1
Sequence:CCGGCTGTGGGCATTGAGCATCATTCTCGAGAATGATGCTCAATGCCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021819.1-306s1c1
Sequence:CCGGGCCTGGGAAGTAGAGGTGCAACTCGAGTTGCACCTCTACTTCCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021819.1-1448s1c1
Sequence:CCGGCCTCATTCAGACTGTAGGCTTCTCGAGAAGCCTACAGTCTGAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021819.2-562s21c1
Sequence:CCGGTCAGAGCACGGATCACCTACTCTCGAGAGTAGGTGATCCGTGCTCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021819.2-397s21c1
Sequence:CCGGACGGCATCGGGATCTTCTTTGCTCGAGCAAAGAAGATCCCGATGCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021819
LMAN1L MISSION shRNA Lentiviral Transduction Particles
lectin, mannose-binding, 1 like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021819.1-138s1c1
Sequence:CCGGGAGTACAAGCTCAGCTTCAAACTCGAGTTTGAAGCTGAGCTTGTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021819.1-1148s1c1
Sequence:CCGGCCTCTCCATGTCACTCAATAACTCGAGTTATTGAGTGACATGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021819.1-1285s1c1
Sequence:CCGGCTGTGGGCATTGAGCATCATTCTCGAGAATGATGCTCAATGCCCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021819.1-306s1c1
Sequence:CCGGGCCTGGGAAGTAGAGGTGCAACTCGAGTTGCACCTCTACTTCCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021819.1-1448s1c1
Sequence:CCGGCCTCATTCAGACTGTAGGCTTCTCGAGAAGCCTACAGTCTGAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021819.2-562s21c1
Sequence:CCGGTCAGAGCACGGATCACCTACTCTCGAGAGTAGGTGATCCGTGCTCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021819.2-397s21c1
Sequence:CCGGACGGCATCGGGATCTTCTTTGCTCGAGCAAAGAAGATCCCGATGCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)