EMAIL THIS PAGE TO A FRIEND

LMAN2L

lectin, mannose-binding 2-like

119 Gene Product Result for
Synonyms: VIPL
Gene ID:
Mouse(214895) lectin, mannose-binding 2-like
Rat(301343) lectin, mannose-binding 2-like
domestic guinea pig(100722085) lectin, mannose-binding 2-like
naked mole-rat(101709466) lectin, mannose-binding 2-like
sheep(101111177) lectin, mannose-binding 2-like
Domestic Rabbit(100348811) lectin, mannose-binding 2-like
cow(539289) lectin, mannose-binding 2-like
domestic cat(101091780) lectin, mannose-binding 2-like
dog(474569) lectin, mannose-binding 2-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013374 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013374 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013374 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030805 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030805 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030805 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030805 Rosetta Predictions human pricing
NM_001106900 Rosetta Predictions rat pricing
NM_001013374 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245252 predicted 627
2 SASI_Hs01_00245253 predicted 700
3 SASI_Hs01_00245254 predicted 1012
4 SASI_Hs01_00245255 predicted 629
5 SASI_Hs01_00245256 predicted 1011
6 SASI_Hs01_00245257 predicted 674
7 SASI_Hs01_00245258 predicted 802
8 SASI_Hs01_00245260 predicted 690
9 SASI_Hs01_00245261 predicted 824
10 SASI_Hs02_00358373 predicted 683
11 SASI_Hs01_00245259 predicted 824
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106900 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223516 predicted 382
2 SASI_Rn02_00223517 predicted 281
3 SASI_Rn02_00223518 predicted 260
4 SASI_Rn02_00223519 predicted 280
5 SASI_Rn02_00223520 predicted 283
6 SASI_Rn02_00223521 predicted 198
7 SASI_Rn02_00223522 predicted 284
8 SASI_Rn02_00223523 predicted 230
9 SASI_Rn02_00223524 predicted 287
10 SASI_Rn02_00223525 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121952 predicted 675
2 SASI_Mm01_00121953 predicted 792
3 SASI_Mm01_00121955 predicted 986
4 SASI_Mm01_00121956 predicted 457
5 SASI_Mm01_00121957 predicted 667
6 SASI_Mm01_00121958 predicted 602
7 SASI_Mm01_00121959 predicted 800
8 SASI_Mm01_00121960 predicted 616
9 SASI_Mm01_00121961 predicted 1134
10 SASI_Mm02_00287198 predicted 1121
11 SASI_Mm01_00121954 predicted 620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013374
VALIDATED
LMAN2L MISSION shRNA Bacterial Glycerol Stock
lectin, mannose-binding 2-like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000111714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013374.1-601s1c1
Sequence:CCGGTGCACAGCCATTGTCCGAAATCTCGAGATTTCGGACAATGGCTGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013374.1-996s1c1
Sequence:CCGGCGGGATCATACTCTACAACAACTCGAGTTGTTGTAGAGTATGATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013374.1-1299s1c1
Sequence:CCGGCCTGCTGTGATGCCTAAATTACTCGAGTAATTTAGGCATCACAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013374.1-602s1c1
Sequence:CCGGGCACAGCCATTGTCCGAAATACTCGAGTATTTCGGACAATGGCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013374
VALIDATED
LMAN2L MISSION shRNA shRNA Plasmid DNA
lectin, mannose-binding 2-like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000111714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013374.1-601s1c1
Sequence:CCGGTGCACAGCCATTGTCCGAAATCTCGAGATTTCGGACAATGGCTGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013374.1-996s1c1
Sequence:CCGGCGGGATCATACTCTACAACAACTCGAGTTGTTGTAGAGTATGATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013374.1-1299s1c1
Sequence:CCGGCCTGCTGTGATGCCTAAATTACTCGAGTAATTTAGGCATCACAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013374.1-602s1c1
Sequence:CCGGGCACAGCCATTGTCCGAAATACTCGAGTATTTCGGACAATGGCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013374
VALIDATED
LMAN2L MISSION shRNA Lentiviral Transduction Particles
lectin, mannose-binding 2-like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000111714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013374.1-601s1c1
Sequence:CCGGTGCACAGCCATTGTCCGAAATCTCGAGATTTCGGACAATGGCTGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013374.1-996s1c1
Sequence:CCGGCGGGATCATACTCTACAACAACTCGAGTTGTTGTAGAGTATGATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013374.1-1299s1c1
Sequence:CCGGCCTGCTGTGATGCCTAAATTACTCGAGTAATTTAGGCATCACAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013374.1-602s1c1
Sequence:CCGGGCACAGCCATTGTCCGAAATACTCGAGTATTTCGGACAATGGCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030805
LMAN2L MISSION shRNA Bacterial Glycerol Stock
lectin, mannose-binding 2-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030805.1-901s1c1
Sequence:CCGGGCCCTCAGTGGACAATATGAACTCGAGTTCATATTGTCCACTGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030805.1-880s1c1
Sequence:CCGGGCTCCATCGAGATGTGTTCTTCTCGAGAAGAACACATCTCGATGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030805.1-1811s1c1
Sequence:CCGGCCCTCAGTGAAGTTTGGCTAACTCGAGTTAGCCAAACTTCACTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030805.1-913s1c1
Sequence:CCGGCAATATGAAGCTGCCTGAGATCTCGAGATCTCAGGCAGCTTCATATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030805.1-2070s1c1
Sequence:CCGGGCTTGGATATTGCCCAGAGAACTCGAGTTCTCTGGGCAATATCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030805.1-1010s1c1
Sequence:CCGGGCCATAGTCATTGGTATCATACTCGAGTATGATACCAATGACTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030805.1-685s1c1
Sequence:CCGGGAGGCATTTGACGATAATGATCTCGAGATCATTATCGTCAAATGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030805.1-164s1c1
Sequence:CCGGCAAACGTTCGAGTACTTGAAACTCGAGTTTCAAGTACTCGAACGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030805.1-414s1c1
Sequence:CCGGGCTTGGCAATCTGGTACACAACTCGAGTTGTGTACCAGATTGCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030805
LMAN2L MISSION shRNA shRNA Plasmid DNA
lectin, mannose-binding 2-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030805.1-901s1c1
Sequence:CCGGGCCCTCAGTGGACAATATGAACTCGAGTTCATATTGTCCACTGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030805.1-880s1c1
Sequence:CCGGGCTCCATCGAGATGTGTTCTTCTCGAGAAGAACACATCTCGATGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030805.1-1811s1c1
Sequence:CCGGCCCTCAGTGAAGTTTGGCTAACTCGAGTTAGCCAAACTTCACTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030805.1-913s1c1
Sequence:CCGGCAATATGAAGCTGCCTGAGATCTCGAGATCTCAGGCAGCTTCATATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030805.1-2070s1c1
Sequence:CCGGGCTTGGATATTGCCCAGAGAACTCGAGTTCTCTGGGCAATATCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030805.1-1010s1c1
Sequence:CCGGGCCATAGTCATTGGTATCATACTCGAGTATGATACCAATGACTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030805.1-685s1c1
Sequence:CCGGGAGGCATTTGACGATAATGATCTCGAGATCATTATCGTCAAATGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030805.1-164s1c1
Sequence:CCGGCAAACGTTCGAGTACTTGAAACTCGAGTTTCAAGTACTCGAACGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030805.1-414s1c1
Sequence:CCGGGCTTGGCAATCTGGTACACAACTCGAGTTGTGTACCAGATTGCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030805
LMAN2L MISSION shRNA Lentiviral Transduction Particles
lectin, mannose-binding 2-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030805.1-901s1c1
Sequence:CCGGGCCCTCAGTGGACAATATGAACTCGAGTTCATATTGTCCACTGAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030805.1-880s1c1
Sequence:CCGGGCTCCATCGAGATGTGTTCTTCTCGAGAAGAACACATCTCGATGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030805.1-1811s1c1
Sequence:CCGGCCCTCAGTGAAGTTTGGCTAACTCGAGTTAGCCAAACTTCACTGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030805.1-913s1c1
Sequence:CCGGCAATATGAAGCTGCCTGAGATCTCGAGATCTCAGGCAGCTTCATATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030805.1-2070s1c1
Sequence:CCGGGCTTGGATATTGCCCAGAGAACTCGAGTTCTCTGGGCAATATCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030805.1-1010s1c1
Sequence:CCGGGCCATAGTCATTGGTATCATACTCGAGTATGATACCAATGACTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030805.1-685s1c1
Sequence:CCGGGAGGCATTTGACGATAATGATCTCGAGATCATTATCGTCAAATGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030805.1-164s1c1
Sequence:CCGGCAAACGTTCGAGTACTTGAAACTCGAGTTTCAAGTACTCGAACGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030805.1-414s1c1
Sequence:CCGGGCTTGGCAATCTGGTACACAACTCGAGTTGTGTACCAGATTGCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)