EMAIL THIS PAGE TO A FRIEND

LMBR1

limb development membrane protein 1

64 Gene Product Result for
Synonyms: ACHP C7orf2 DIF14 PPD2 TPT ZRS
Gene ID:
Human(64327) Summary: This gene encodes a member of the LMBR1-like membrane protein family. Another member of this protein family has been shown to be a lipocalin transmembrane receptor. A highly conserved, cis-acting regulatory module for the sonic hedgehog gene is located within an intron of this gene. Consequently, disruption of this genic region can alter sonic hedgehog expression and affect limb patterning, but it is not known if this gene functions directly in limb development. Mutations and chromosomal deletions and rearrangements in this genic region are associated with acheiropody and preaxial polydactyly, which likely result from altered sonic hedgehog expression. [provided by RefSeq, Jul 2008]
Mouse(56873) limb region 1
Rat(362295) limb development membrane protein 1
sheep(101117926) limb region 1 homolog (mouse)
Domestic Rabbit(100352265) limb region 1 homolog (mouse)
domestic guinea pig(100733690) limb region 1 homolog (mouse)
naked mole-rat(101719197) limb region 1 homolog (mouse)
Zebrafish(557300) limb region 1 homolog (mouse)
dog(482819) limb region 1 homolog (mouse)
domestic cat(101088917) limb region 1 homolog (mouse)
Horse(100066736) limb region 1 homolog (mouse)
cow(519337) limb region 1 homolog (mouse)
chicken(373986) limb region 1 homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020295 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020295 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020295 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022458 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022458 Rosetta Predictions human pricing
XM_001054970 Rosetta Predictions rat pricing
XM_342608 Rosetta Predictions rat pricing
NM_020295 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185278 predicted 652
2 SASI_Hs01_00185279 predicted 942
3 SASI_Hs01_00185280 predicted 1161
4 SASI_Hs01_00185281 predicted 1094
5 SASI_Hs01_00185282 predicted 766
6 SASI_Hs02_00355727 predicted 517
7 SASI_Hs02_00355728 predicted 1296
8 SASI_Hs01_00185283 predicted 702
9 SASI_Hs01_00185285 predicted 447
10 SASI_Hs01_00185287 predicted 955
11 SASI_Hs01_00185284 predicted 760
12 SASI_Hs01_00185286 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277882 predicted 1226
2 SASI_Rn02_00277883 predicted 694
3 SASI_Rn02_00277884 predicted 771
4 SASI_Rn02_00277885 predicted 557
5 SASI_Rn02_00277886 predicted 885
6 SASI_Rn02_00277887 predicted 530
7 SASI_Rn02_00277888 predicted 1027
8 SASI_Rn02_00277889 predicted 569
9 SASI_Rn02_00277890 predicted 896
10 SASI_Rn02_00277891 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342608 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394540 predicted 1217
2 SASI_Rn02_00394541 predicted 695
3 SASI_Rn02_00394542 predicted 765
4 SASI_Rn02_00394543 predicted 551
5 SASI_Rn02_00394544 predicted 885
6 SASI_Rn02_00394545 predicted 521
7 SASI_Rn02_00394546 predicted 1027
8 SASI_Rn02_00394547 predicted 569
9 SASI_Rn02_00394548 predicted 900
10 SASI_Rn02_00394549 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020295 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325514 predicted 1083
2 SASI_Mm02_00325515 predicted 291
3 SASI_Mm02_00325516 predicted 721
4 SASI_Mm02_00325517 predicted 1226
5 SASI_Mm02_00325518 predicted 760
6 SASI_Mm02_00325519 predicted 1009
7 SASI_Mm02_00325520 predicted 750
8 SASI_Mm02_00325521 predicted 1730
9 SASI_Mm02_00325522 predicted 1444
10 SASI_Mm02_00325523 predicted 1073
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020295
VALIDATED
LMBR1 MISSION shRNA Bacterial Glycerol Stock
limb development membrane protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020295.2-571s1c1
Sequence:CCGGCCCTATTTGTATTCTTGCATTCTCGAGAATGCAAGAATACAAATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020295.2-570s1c1
Sequence:CCGGGCCCTATTTGTATTCTTGCATCTCGAGATGCAAGAATACAAATAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020295.2-1045s1c1
Sequence:CCGGGCACTTGAAATCATTCTGATTCTCGAGAATCAGAATGATTTCAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020295.2-526s1c1
Sequence:CCGGGCTGCCAGTATGGAGTCTTTACTCGAGTAAAGACTCCATACTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020295.2-529s1c1
Sequence:CCGGGCCAGTATGGAGTCTTTATATCTCGAGATATAAAGACTCCATACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020295
VALIDATED
LMBR1 MISSION shRNA shRNA Plasmid DNA
limb development membrane protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020295.2-571s1c1
Sequence:CCGGCCCTATTTGTATTCTTGCATTCTCGAGAATGCAAGAATACAAATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020295.2-570s1c1
Sequence:CCGGGCCCTATTTGTATTCTTGCATCTCGAGATGCAAGAATACAAATAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020295.2-1045s1c1
Sequence:CCGGGCACTTGAAATCATTCTGATTCTCGAGAATCAGAATGATTTCAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020295.2-526s1c1
Sequence:CCGGGCTGCCAGTATGGAGTCTTTACTCGAGTAAAGACTCCATACTGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020295.2-529s1c1
Sequence:CCGGGCCAGTATGGAGTCTTTATATCTCGAGATATAAAGACTCCATACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020295
VALIDATED
LMBR1 MISSION shRNA Lentiviral Transduction Particles
limb development membrane protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020295.2-571s1c1
Sequence:CCGGCCCTATTTGTATTCTTGCATTCTCGAGAATGCAAGAATACAAATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020295.2-570s1c1
Sequence:CCGGGCCCTATTTGTATTCTTGCATCTCGAGATGCAAGAATACAAATAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020295.2-1045s1c1
Sequence:CCGGGCACTTGAAATCATTCTGATTCTCGAGAATCAGAATGATTTCAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020295.2-526s1c1
Sequence:CCGGGCTGCCAGTATGGAGTCTTTACTCGAGTAAAGACTCCATACTGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020295.2-529s1c1
Sequence:CCGGGCCAGTATGGAGTCTTTATATCTCGAGATATAAAGACTCCATACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022458
VALIDATED
LMBR1 MISSION shRNA Bacterial Glycerol Stock
limb development membrane protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_022458.2-713s1c1
Sequence:CCGGGAGTTCTATCTACCCTATTTACTCGAGTAAATAGGGTAGATAGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_022458.2-1404s1c1
Sequence:CCGGGCGACTTTGGAAGGTTTAATTCTCGAGAATTAAACCTTCCAAAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_022458.2-216s1c1
Sequence:CCGGCCACGATATGTTTCCTTCTTTCTCGAGAAAGAAGGAAACATATCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_022458.2-913s1c1
Sequence:CCGGGCTGTCTTCATCGGTGGAATACTCGAGTATTCCACCGATGAAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022458.2-2395s1c1
Sequence:CCGGCCAGTGTTTAATACACTTGTACTCGAGTACAAGTGTATTAAACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022458.3-679s21c1
Sequence:CCGGTTCTTCTTGCGTTACTCATTCCTCGAGGAATGAGTAACGCAAGAAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022458.3-299s21c1
Sequence:CCCGTGCCATTCTCTACGTTGTTTCCTCGAGGAAACAACGTAGAGAATGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022458.3-741s21c1
Sequence:CCGGGCCGCAAGCATGGAATCTTTACTCGAGTAAAGATTCCATGCTTGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022458.3-1950s21c1
Sequence:CCGGATTTGCTCATGTTGGTAAATACTCGAGTATTTACCAACATGAGCAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022458.3-2108s21c1
Sequence:CCGGTGGTACTAAGTGAAGCTTATTCTCGAGAATAAGCTTCACTTAGTACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022458
VALIDATED
LMBR1 MISSION shRNA shRNA Plasmid DNA
limb development membrane protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_022458.2-713s1c1
Sequence:CCGGGAGTTCTATCTACCCTATTTACTCGAGTAAATAGGGTAGATAGAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_022458.2-1404s1c1
Sequence:CCGGGCGACTTTGGAAGGTTTAATTCTCGAGAATTAAACCTTCCAAAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_022458.2-216s1c1
Sequence:CCGGCCACGATATGTTTCCTTCTTTCTCGAGAAAGAAGGAAACATATCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_022458.2-913s1c1
Sequence:CCGGGCTGTCTTCATCGGTGGAATACTCGAGTATTCCACCGATGAAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022458.2-2395s1c1
Sequence:CCGGCCAGTGTTTAATACACTTGTACTCGAGTACAAGTGTATTAAACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022458.3-679s21c1
Sequence:CCGGTTCTTCTTGCGTTACTCATTCCTCGAGGAATGAGTAACGCAAGAAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022458.3-299s21c1
Sequence:CCCGTGCCATTCTCTACGTTGTTTCCTCGAGGAAACAACGTAGAGAATGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022458.3-741s21c1
Sequence:CCGGGCCGCAAGCATGGAATCTTTACTCGAGTAAAGATTCCATGCTTGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022458.3-1950s21c1
Sequence:CCGGATTTGCTCATGTTGGTAAATACTCGAGTATTTACCAACATGAGCAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022458.3-2108s21c1
Sequence:CCGGTGGTACTAAGTGAAGCTTATTCTCGAGAATAAGCTTCACTTAGTACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022458
VALIDATED
LMBR1 MISSION shRNA Lentiviral Transduction Particles
limb development membrane protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_022458.2-713s1c1
Sequence:CCGGGAGTTCTATCTACCCTATTTACTCGAGTAAATAGGGTAGATAGAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_022458.2-1404s1c1
Sequence:CCGGGCGACTTTGGAAGGTTTAATTCTCGAGAATTAAACCTTCCAAAGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_022458.2-216s1c1
Sequence:CCGGCCACGATATGTTTCCTTCTTTCTCGAGAAAGAAGGAAACATATCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_022458.2-913s1c1
Sequence:CCGGGCTGTCTTCATCGGTGGAATACTCGAGTATTCCACCGATGAAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022458.2-2395s1c1
Sequence:CCGGCCAGTGTTTAATACACTTGTACTCGAGTACAAGTGTATTAAACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022458.3-679s21c1
Sequence:CCGGTTCTTCTTGCGTTACTCATTCCTCGAGGAATGAGTAACGCAAGAAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022458.3-299s21c1
Sequence:CCCGTGCCATTCTCTACGTTGTTTCCTCGAGGAAACAACGTAGAGAATGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022458.3-741s21c1
Sequence:CCGGGCCGCAAGCATGGAATCTTTACTCGAGTAAAGATTCCATGCTTGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022458.3-1950s21c1
Sequence:CCGGATTTGCTCATGTTGGTAAATACTCGAGTATTTACCAACATGAGCAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022458.3-2108s21c1
Sequence:CCGGTGGTACTAAGTGAAGCTTATTCTCGAGAATAAGCTTCACTTAGTACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)