EMAIL THIS PAGE TO A FRIEND

LMBR1L

limb development membrane protein 1-like

121 Gene Product Result for
Synonyms: LIMR
Gene ID:
Mouse(74775) limb region 1 like
Rat(300215) limb region 1 like
Zebrafish(321314) limb region 1 like
cow(539015) limb region 1 homolog (mouse)-like
Horse(100051779) limb region 1 homolog (mouse)-like
domestic cat(101095989) limb region 1 homolog (mouse)-like
dog(612809) limb region 1 homolog (mouse)-like
domestic guinea pig(100727250) limb region 1 homolog (mouse)-like
naked mole-rat(101717393) limb region 1 homolog (mouse)-like
sheep(101102713) limb region 1 homolog (mouse)-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029098 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029098 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029098 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018113 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018113 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018113 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018113 Rosetta Predictions human pricing
NM_001013950 Rosetta Predictions rat pricing
NM_029098 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076682 predicted 1281
2 SASI_Hs02_00351309 predicted 1611
3 SASI_Hs02_00351310 predicted 1388
4 SASI_Hs02_00351311 predicted 415
5 SASI_Hs02_00351312 predicted 376
6 SASI_Hs02_00351313 predicted 1603
7 SASI_Hs02_00351314 predicted 1435
8 SASI_Hs02_00351315 predicted 880
9 SASI_Hs02_00351316 predicted 461
10 SASI_Hs02_00351317 predicted 1618
11 SASI_Hs01_00076683 predicted 2100
12 SASI_Hs01_00076684 predicted 780
13 SASI_Hs01_00076685 predicted 1548
14 SASI_Hs01_00076686 predicted 1430
15 SASI_Hs01_00076687 predicted 1496
16 SASI_Hs01_00076688 predicted 2105
17 SASI_Hs01_00076689 predicted 873
18 SASI_Hs01_00076690 predicted 831
19 SASI_Hs01_00076691 predicted 1933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013950 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075590 predicted 210
2 SASI_Rn01_00075591 predicted 672
3 SASI_Rn02_00201263 predicted 505
4 SASI_Rn01_00075592 predicted 638
5 SASI_Rn02_00201264 predicted 586
6 SASI_Rn01_00075593 predicted 504
7 SASI_Rn01_00075594 predicted 294
8 SASI_Rn01_00075595 predicted 380
9 SASI_Rn01_00075596 predicted 490
10 SASI_Rn01_00075598 predicted 279
11 SASI_Rn01_00075597 predicted 675
12 SASI_Rn01_00075599 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029098 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058208 predicted 207
2 SASI_Mm01_00058209 predicted 1281
3 SASI_Mm01_00058210 predicted 1448
4 SASI_Mm01_00058212 predicted 1440
5 SASI_Mm02_00334864 predicted 1500
6 SASI_Mm01_00058213 predicted 346
7 SASI_Mm01_00058214 predicted 930
8 SASI_Mm02_00334865 predicted 786
9 SASI_Mm01_00058215 predicted 547
10 SASI_Mm01_00058216 predicted 969
11 SASI_Mm01_00058211 predicted 564
12 SASI_Mm01_00058217 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029098
VALIDATED
LMBR1L MISSION shRNA Bacterial Glycerol Stock
limb development membrane protein 1-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029098.3-1942s21c1
Sequence:CCGGGCCATGTTTACATGATTTGATCTCGAGATCAAATCATGTAAACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029098.3-1240s21c1
Sequence:CCGGATCCAGGTTGTGCTGATATTTCTCGAGAAATATCAGCACAACCTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029098.3-274s21c1
Sequence:CCGGCTCTACATCCTCTGCCATATCCTCGAGGATATGGCAGAGGATGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029098.3-1337s21c1
Sequence:CCGGCATCGATGACACAGATCATTGCTCGAGCAATGATCTGTGTCATCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029098.3-922s21c1
Sequence:CCGGGCAGCTCTGACTCGAAGAATCCTCGAGGATTCTTCGAGTCAGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029098.2-1943s1c1
Sequence:CCGGGCCATGTTTACATGATTTGATCTCGAGATCAAATCATGTAAACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029098.2-548s1c1
Sequence:CCGGCTCGTCTTCCTTATGCCCTTTCTCGAGAAAGGGCATAAGGAAGACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029098.2-1454s1c1
Sequence:CCGGCGCTTCAACTGGCTAGGCAATCTCGAGATTGCCTAGCCAGTTGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029098.2-692s1c1
Sequence:CCGGGCATCCGCCATTGTAGACAATCTCGAGATTGTCTACAATGGCGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029098.2-239s1c1
Sequence:CCGGCGCGAGTGCATCATCTCAATACTCGAGTATTGAGATGATGCACTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029098
VALIDATED
LMBR1L MISSION shRNA shRNA Plasmid DNA
limb development membrane protein 1-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029098.3-1942s21c1
Sequence:CCGGGCCATGTTTACATGATTTGATCTCGAGATCAAATCATGTAAACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029098.3-1240s21c1
Sequence:CCGGATCCAGGTTGTGCTGATATTTCTCGAGAAATATCAGCACAACCTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029098.3-274s21c1
Sequence:CCGGCTCTACATCCTCTGCCATATCCTCGAGGATATGGCAGAGGATGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029098.3-1337s21c1
Sequence:CCGGCATCGATGACACAGATCATTGCTCGAGCAATGATCTGTGTCATCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029098.3-922s21c1
Sequence:CCGGGCAGCTCTGACTCGAAGAATCCTCGAGGATTCTTCGAGTCAGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029098.2-1943s1c1
Sequence:CCGGGCCATGTTTACATGATTTGATCTCGAGATCAAATCATGTAAACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029098.2-548s1c1
Sequence:CCGGCTCGTCTTCCTTATGCCCTTTCTCGAGAAAGGGCATAAGGAAGACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029098.2-1454s1c1
Sequence:CCGGCGCTTCAACTGGCTAGGCAATCTCGAGATTGCCTAGCCAGTTGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029098.2-692s1c1
Sequence:CCGGGCATCCGCCATTGTAGACAATCTCGAGATTGTCTACAATGGCGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029098.2-239s1c1
Sequence:CCGGCGCGAGTGCATCATCTCAATACTCGAGTATTGAGATGATGCACTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029098
VALIDATED
LMBR1L MISSION shRNA Lentiviral Transduction Particles
limb development membrane protein 1-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029098.3-1942s21c1
Sequence:CCGGGCCATGTTTACATGATTTGATCTCGAGATCAAATCATGTAAACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029098.3-1240s21c1
Sequence:CCGGATCCAGGTTGTGCTGATATTTCTCGAGAAATATCAGCACAACCTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029098.3-274s21c1
Sequence:CCGGCTCTACATCCTCTGCCATATCCTCGAGGATATGGCAGAGGATGTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029098.3-1337s21c1
Sequence:CCGGCATCGATGACACAGATCATTGCTCGAGCAATGATCTGTGTCATCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029098.3-922s21c1
Sequence:CCGGGCAGCTCTGACTCGAAGAATCCTCGAGGATTCTTCGAGTCAGAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029098.2-1943s1c1
Sequence:CCGGGCCATGTTTACATGATTTGATCTCGAGATCAAATCATGTAAACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029098.2-548s1c1
Sequence:CCGGCTCGTCTTCCTTATGCCCTTTCTCGAGAAAGGGCATAAGGAAGACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029098.2-1454s1c1
Sequence:CCGGCGCTTCAACTGGCTAGGCAATCTCGAGATTGCCTAGCCAGTTGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029098.2-692s1c1
Sequence:CCGGGCATCCGCCATTGTAGACAATCTCGAGATTGTCTACAATGGCGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029098.2-239s1c1
Sequence:CCGGCGCGAGTGCATCATCTCAATACTCGAGTATTGAGATGATGCACTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018113
VALIDATED
LMBR1L MISSION shRNA Bacterial Glycerol Stock
limb development membrane protein 1-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018113.2-1499s21c1
Sequence:CCGGACACTGCCATGACGCAGATAACTCGAGTTATCTGCGTCATGGCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_018113.2-394s21c1
Sequence:CCGGGAGAGGATCCGCGAGTGTATTCTCGAGAATACACTCGCGGATCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018113.2-2111s21c1
Sequence:CCGGATAGCCATGTTTACATGATTTCTCGAGAAATCATGTAAACATGGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018113.2-1621s21c1
Sequence:CCGGTTCAACTGGCTGGGCAATTTCCTCGAGGAAATTGCCCAGCCAGTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_018113.1-869s1c1
Sequence:CCGGGCCAACAGAGAGTCACTCTATCTCGAGATAGAGTGACTCTCTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018113.1-1487s1c1
Sequence:CCGGACTGCCATGACGCAGATAATTCTCGAGAATTATCTGCGTCATGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018113.1-377s1c1
Sequence:CCGGGTGAGCAACTGCTGGATGAATCTCGAGATTCATCCAGCAGTTGCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_018113.1-1086s1c1
Sequence:CCGGGCAGGATCTGTAATCCTACTTCTCGAGAAGTAGGATTACAGATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_018113.1-1118s1c1
Sequence:CCGGCCTTTAGACATGGAGCTGCTACTCGAGTAGCAGCTCCATGTCTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018113
VALIDATED
LMBR1L MISSION shRNA shRNA Plasmid DNA
limb development membrane protein 1-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018113.2-1499s21c1
Sequence:CCGGACACTGCCATGACGCAGATAACTCGAGTTATCTGCGTCATGGCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_018113.2-394s21c1
Sequence:CCGGGAGAGGATCCGCGAGTGTATTCTCGAGAATACACTCGCGGATCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018113.2-2111s21c1
Sequence:CCGGATAGCCATGTTTACATGATTTCTCGAGAAATCATGTAAACATGGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018113.2-1621s21c1
Sequence:CCGGTTCAACTGGCTGGGCAATTTCCTCGAGGAAATTGCCCAGCCAGTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_018113.1-869s1c1
Sequence:CCGGGCCAACAGAGAGTCACTCTATCTCGAGATAGAGTGACTCTCTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018113.1-1487s1c1
Sequence:CCGGACTGCCATGACGCAGATAATTCTCGAGAATTATCTGCGTCATGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018113.1-377s1c1
Sequence:CCGGGTGAGCAACTGCTGGATGAATCTCGAGATTCATCCAGCAGTTGCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_018113.1-1086s1c1
Sequence:CCGGGCAGGATCTGTAATCCTACTTCTCGAGAAGTAGGATTACAGATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_018113.1-1118s1c1
Sequence:CCGGCCTTTAGACATGGAGCTGCTACTCGAGTAGCAGCTCCATGTCTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018113
VALIDATED
LMBR1L MISSION shRNA Lentiviral Transduction Particles
limb development membrane protein 1-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018113.2-1499s21c1
Sequence:CCGGACACTGCCATGACGCAGATAACTCGAGTTATCTGCGTCATGGCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_018113.2-394s21c1
Sequence:CCGGGAGAGGATCCGCGAGTGTATTCTCGAGAATACACTCGCGGATCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018113.2-2111s21c1
Sequence:CCGGATAGCCATGTTTACATGATTTCTCGAGAAATCATGTAAACATGGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018113.2-1621s21c1
Sequence:CCGGTTCAACTGGCTGGGCAATTTCCTCGAGGAAATTGCCCAGCCAGTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_018113.1-869s1c1
Sequence:CCGGGCCAACAGAGAGTCACTCTATCTCGAGATAGAGTGACTCTCTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_018113.1-1487s1c1
Sequence:CCGGACTGCCATGACGCAGATAATTCTCGAGAATTATCTGCGTCATGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018113.1-377s1c1
Sequence:CCGGGTGAGCAACTGCTGGATGAATCTCGAGATTCATCCAGCAGTTGCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_018113.1-1086s1c1
Sequence:CCGGGCAGGATCTGTAATCCTACTTCTCGAGAAGTAGGATTACAGATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_018113.1-1118s1c1
Sequence:CCGGCCTTTAGACATGGAGCTGCTACTCGAGTAGCAGCTCCATGTCTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)