EMAIL THIS PAGE TO A FRIEND

LMBRD1

LMBR1 domain containing 1

67 Gene Product Result for
Synonyms: C6orf209 LMBD1 MAHCF NESI
Gene ID:
Human(55788) Summary: This gene encodes a lysosomal membrane protein that may be involved in the transport and metabolism of cobalamin. This protein also interacts with the large form of the hepatitis delta antigen and may be required for the nucleocytoplasmic shuttling of the hepatitis delta virus. Mutations in this gene are associated with the vitamin B12 metabolism disorder termed, homocystinuria-megaloblastic anemia complementation type F.[provided by RefSeq, Oct 2009]
Mouse(68421) LMBR1 domain containing 1
Rat(246046) LMBR1 domain containing 1
sheep(101108924) LMBR1 domain containing 1
Zebrafish(323720) LMBR1 domain containing 1
cow(510495) LMBR1 domain containing 1
Horse(100057167) LMBR1 domain containing 1
domestic cat(101085633) LMBR1 domain containing 1
dog(474955) LMBR1 domain containing 1
chicken(421874) LMBR1 domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026719 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026719 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026719 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018368 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018368 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018368 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018368 Rosetta Predictions human pricing
NM_139189 Rosetta Predictions rat pricing
NM_026719 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161035 predicted 1107
2 SASI_Hs01_00161036 predicted 536
3 SASI_Hs01_00161037 predicted 1375
4 SASI_Hs01_00161039 predicted 841
5 SASI_Hs01_00161040 predicted 723
6 SASI_Hs02_00351839 predicted 1802
7 SASI_Hs01_00161042 predicted 1548
8 SASI_Hs01_00161043 predicted 1260
9 SASI_Hs01_00161044 predicted 1534
10 SASI_Hs02_00351840 predicted 284
11 SASI_Hs01_00161038 predicted 1181
12 SASI_Hs01_00161041 predicted 1580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139189 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111928 predicted 1399
2 SASI_Rn01_00111929 predicted 1122
3 SASI_Rn01_00111930 predicted 884
4 SASI_Rn01_00111931 predicted 1596
5 SASI_Rn01_00111932 predicted 501
6 SASI_Rn01_00111933 predicted 1316
7 SASI_Rn01_00111934 predicted 1082
8 SASI_Rn01_00111935 predicted 725
9 SASI_Rn01_00111936 predicted 847
10 SASI_Rn01_00111937 predicted 1512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134160 predicted 1774
2 SASI_Mm01_00134161 predicted 1520
3 SASI_Mm01_00134162 predicted 1202
4 SASI_Mm02_00330755 predicted 1436
5 SASI_Mm01_00134163 predicted 624
6 SASI_Mm01_00134165 predicted 1854
7 SASI_Mm01_00134166 predicted 1831
8 SASI_Mm01_00134167 predicted 1250
9 SASI_Mm01_00134168 predicted 598
10 SASI_Mm01_00134169 predicted 497
11 SASI_Mm01_00134164 predicted 1734
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026719
VALIDATED
LMBRD1 MISSION shRNA Bacterial Glycerol Stock
LMBR1 domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026719.1-2589s1c1
Sequence:CCGGCCCATAACATAATGAGTCTAACTCGAGTTAGACTCATTATGTTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026719.1-790s1c1
Sequence:CCGGCCGTTCTGTATGGCTACTATACTCGAGTATAGTAGCCATACAGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026719.1-1302s1c1
Sequence:CCGGCGTGCCTTAAAGCAATGTGAACTCGAGTTCACATTGCTTTAAGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026719.1-1305s1c1
Sequence:CCGGGCCTTAAAGCAATGTGAAGAACTCGAGTTCTTCACATTGCTTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026719.1-1592s1c1
Sequence:CCGGCCCTCTTGATTACATTCTTATCTCGAGATAAGAATGTAATCAAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026719.2-389s21c1
Sequence:CCGGCACTGCTGCCGGTGGATATATCTCGAGATATATCCACCGGCAGCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026719.2-1006s21c1
Sequence:CCGGGCCTTAAAGCAATGTGAAGAACTCGAGTTCTTCACATTGCTTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026719.2-1293s21c1
Sequence:CCGGCCCTCTTGATTACATTCTTATCTCGAGATAAGAATGTAATCAAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026719.2-1775s21c1
Sequence:CCGGTGGATGAAGATTCGGACTTAACTCGAGTTAAGTCCGAATCTTCATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026719.2-1834s21c1
Sequence:CCGGTTCTGTCCTAAGGGCTTAATGCTCGAGCATTAAGCCCTTAGGACAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026719
VALIDATED
LMBRD1 MISSION shRNA shRNA Plasmid DNA
LMBR1 domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026719.1-2589s1c1
Sequence:CCGGCCCATAACATAATGAGTCTAACTCGAGTTAGACTCATTATGTTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026719.1-790s1c1
Sequence:CCGGCCGTTCTGTATGGCTACTATACTCGAGTATAGTAGCCATACAGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026719.1-1302s1c1
Sequence:CCGGCGTGCCTTAAAGCAATGTGAACTCGAGTTCACATTGCTTTAAGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026719.1-1305s1c1
Sequence:CCGGGCCTTAAAGCAATGTGAAGAACTCGAGTTCTTCACATTGCTTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026719.1-1592s1c1
Sequence:CCGGCCCTCTTGATTACATTCTTATCTCGAGATAAGAATGTAATCAAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026719.2-389s21c1
Sequence:CCGGCACTGCTGCCGGTGGATATATCTCGAGATATATCCACCGGCAGCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026719.2-1006s21c1
Sequence:CCGGGCCTTAAAGCAATGTGAAGAACTCGAGTTCTTCACATTGCTTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026719.2-1293s21c1
Sequence:CCGGCCCTCTTGATTACATTCTTATCTCGAGATAAGAATGTAATCAAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026719.2-1775s21c1
Sequence:CCGGTGGATGAAGATTCGGACTTAACTCGAGTTAAGTCCGAATCTTCATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026719.2-1834s21c1
Sequence:CCGGTTCTGTCCTAAGGGCTTAATGCTCGAGCATTAAGCCCTTAGGACAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026719
VALIDATED
LMBRD1 MISSION shRNA Lentiviral Transduction Particles
LMBR1 domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026719.1-2589s1c1
Sequence:CCGGCCCATAACATAATGAGTCTAACTCGAGTTAGACTCATTATGTTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026719.1-790s1c1
Sequence:CCGGCCGTTCTGTATGGCTACTATACTCGAGTATAGTAGCCATACAGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026719.1-1302s1c1
Sequence:CCGGCGTGCCTTAAAGCAATGTGAACTCGAGTTCACATTGCTTTAAGGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026719.1-1305s1c1
Sequence:CCGGGCCTTAAAGCAATGTGAAGAACTCGAGTTCTTCACATTGCTTTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026719.1-1592s1c1
Sequence:CCGGCCCTCTTGATTACATTCTTATCTCGAGATAAGAATGTAATCAAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026719.2-389s21c1
Sequence:CCGGCACTGCTGCCGGTGGATATATCTCGAGATATATCCACCGGCAGCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026719.2-1006s21c1
Sequence:CCGGGCCTTAAAGCAATGTGAAGAACTCGAGTTCTTCACATTGCTTTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026719.2-1293s21c1
Sequence:CCGGCCCTCTTGATTACATTCTTATCTCGAGATAAGAATGTAATCAAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026719.2-1775s21c1
Sequence:CCGGTGGATGAAGATTCGGACTTAACTCGAGTTAAGTCCGAATCTTCATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026719.2-1834s21c1
Sequence:CCGGTTCTGTCCTAAGGGCTTAATGCTCGAGCATTAAGCCCTTAGGACAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018368
VALIDATED
LMBRD1 MISSION shRNA Bacterial Glycerol Stock
LMBR1 domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018368.2-1526s1c1
Sequence:CCGGCCTGAAGATCAGTGTACTGTTCTCGAGAACAGTACACTGATCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018368.2-171s1c1
Sequence:CCGGGCCTCTTACTACTGGCTATTTCTCGAGAAATAGCCAGTAGTAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018368.2-1413s1c1
Sequence:CCGGCCCAATATGTTATGTATGGAACTCGAGTTCCATACATAACATATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018368.2-284s1c1
Sequence:CCGGGCACTTATCACATCAGCACTTCTCGAGAAGTGCTGATGTGATAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018368.2-767s1c1
Sequence:CCGGGCGTTACCTTTAAATCTGATACTCGAGTATCAGATTTAAAGGTAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018368.2-1526s21c1
Sequence:CCGGCCTGAAGATCAGTGTACTGTTCTCGAGAACAGTACACTGATCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018368.2-284s21c1
Sequence:CCGGGCACTTATCACATCAGCACTTCTCGAGAAGTGCTGATGTGATAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018368.2-171s21c1
Sequence:CCGGGCCTCTTACTACTGGCTATTTCTCGAGAAATAGCCAGTAGTAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018368.2-767s21c1
Sequence:CCGGGCGTTACCTTTAAATCTGATACTCGAGTATCAGATTTAAAGGTAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018368
VALIDATED
LMBRD1 MISSION shRNA shRNA Plasmid DNA
LMBR1 domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018368.2-1526s1c1
Sequence:CCGGCCTGAAGATCAGTGTACTGTTCTCGAGAACAGTACACTGATCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018368.2-171s1c1
Sequence:CCGGGCCTCTTACTACTGGCTATTTCTCGAGAAATAGCCAGTAGTAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018368.2-1413s1c1
Sequence:CCGGCCCAATATGTTATGTATGGAACTCGAGTTCCATACATAACATATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018368.2-284s1c1
Sequence:CCGGGCACTTATCACATCAGCACTTCTCGAGAAGTGCTGATGTGATAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018368.2-767s1c1
Sequence:CCGGGCGTTACCTTTAAATCTGATACTCGAGTATCAGATTTAAAGGTAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018368.2-1526s21c1
Sequence:CCGGCCTGAAGATCAGTGTACTGTTCTCGAGAACAGTACACTGATCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018368.2-284s21c1
Sequence:CCGGGCACTTATCACATCAGCACTTCTCGAGAAGTGCTGATGTGATAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018368.2-171s21c1
Sequence:CCGGGCCTCTTACTACTGGCTATTTCTCGAGAAATAGCCAGTAGTAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018368.2-767s21c1
Sequence:CCGGGCGTTACCTTTAAATCTGATACTCGAGTATCAGATTTAAAGGTAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018368
VALIDATED
LMBRD1 MISSION shRNA Lentiviral Transduction Particles
LMBR1 domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018368.2-1526s1c1
Sequence:CCGGCCTGAAGATCAGTGTACTGTTCTCGAGAACAGTACACTGATCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018368.2-171s1c1
Sequence:CCGGGCCTCTTACTACTGGCTATTTCTCGAGAAATAGCCAGTAGTAAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018368.2-1413s1c1
Sequence:CCGGCCCAATATGTTATGTATGGAACTCGAGTTCCATACATAACATATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018368.2-284s1c1
Sequence:CCGGGCACTTATCACATCAGCACTTCTCGAGAAGTGCTGATGTGATAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018368.2-767s1c1
Sequence:CCGGGCGTTACCTTTAAATCTGATACTCGAGTATCAGATTTAAAGGTAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018368.2-1526s21c1
Sequence:CCGGCCTGAAGATCAGTGTACTGTTCTCGAGAACAGTACACTGATCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018368.2-284s21c1
Sequence:CCGGGCACTTATCACATCAGCACTTCTCGAGAAGTGCTGATGTGATAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018368.2-171s21c1
Sequence:CCGGGCCTCTTACTACTGGCTATTTCTCGAGAAATAGCCAGTAGTAAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018368.2-767s21c1
Sequence:CCGGGCGTTACCTTTAAATCTGATACTCGAGTATCAGATTTAAAGGTAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)