EMAIL THIS PAGE TO A FRIEND

LMBRD2

LMBR1 domain containing 2

105 Gene Product Result for
UniProtKB ID: Q68DH5, B3KRB6, Q9NTC7
Gene ID:
Mouse(320506) LMBR1 domain containing 2
Rat(499539) LMBR1 domain containing 2
chicken(429640) LMBR1 domain containing 2
cow(510014) LMBR1 domain containing 2
Horse(100067733) LMBR1 domain containing 2
domestic cat(101099528) LMBR1 domain containing 2
dog(489229) LMBR1 domain containing 2
domestic guinea pig(100713747) LMBR1 domain containing 2
naked mole-rat(101707579) LMBR1 domain containing 2
sheep(101109911) LMBR1 domain containing 2
Domestic Rabbit(100341433) LMBR1 domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007527 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007527 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007527 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177178 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177178 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177178 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007527 Rosetta Predictions human pricing
NM_001109177 Rosetta Predictions rat pricing
NM_177178 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225635 predicted 851
2 SASI_Hs01_00225636 predicted 756
3 SASI_Hs01_00225637 predicted 504
4 SASI_Hs01_00225638 predicted 576
5 SASI_Hs01_00225639 predicted 1896
6 SASI_Hs01_00225640 predicted 717
7 SASI_Hs01_00225641 predicted 1184
8 SASI_Hs01_00225642 predicted 599
9 SASI_Hs01_00225643 predicted 1764
10 SASI_Hs02_00305320 predicted 454
11 SASI_Hs01_00225644 predicted 1857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109177 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245880 predicted 559
2 SASI_Rn02_00245881 predicted 414
3 SASI_Rn02_00245882 predicted 2288
4 SASI_Rn02_00245883 predicted 1740
5 SASI_Rn02_00245884 predicted 714
6 SASI_Rn02_00245885 predicted 722
7 SASI_Rn02_00245886 predicted 536
8 SASI_Rn02_00245887 predicted 623
9 SASI_Rn02_00245888 predicted 1658
10 SASI_Rn02_00245889 predicted 1633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201607 predicted 531
2 SASI_Mm01_00201608 predicted 1643
3 SASI_Mm01_00201609 predicted 2261
4 SASI_Mm01_00201610 predicted 2245
5 SASI_Mm01_00201611 predicted 1670
6 SASI_Mm01_00201612 predicted 1261
7 SASI_Mm01_00201613 predicted 1111
8 SASI_Mm01_00201614 predicted 1878
9 SASI_Mm01_00201615 predicted 707
10 SASI_Mm01_00201616 predicted 2330
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007527
LMBRD2 MISSION shRNA Bacterial Glycerol Stock
LMBR1 domain containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007527.1-1769s21c1
Sequence:CCGGGTGTTCAGGATTCGTGTATTTCTCGAGAAATACACGAATCCTGAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007527.1-2032s21c1
Sequence:CCGGTCTCTGCATTGCTACTTATTTCTCGAGAAATAAGTAGCAATGCAGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007527.1-2067s1c1
Sequence:CCGGGTTGTTTGAATCTGCTCGGTTCTCGAGAACCGAGCAGATTCAAACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007527.1-2357s1c1
Sequence:CCGGCGGATAGAACTTCTCCAAGATCTCGAGATCTTGGAGAAGTTCTATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007527.1-2789s1c1
Sequence:CCGGGCAGTTCAGTTTGTTTCAGATCTCGAGATCTGAAACAAACTGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007527.1-2572s1c1
Sequence:CCGGGTACCCTAGAATTTCCTCTATCTCGAGATAGAGGAAATTCTAGGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007527.1-3008s1c1
Sequence:CCGGCAAGGCTTACTTACTAGACATCTCGAGATGTCTAGTAAGTAAGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007527.1-2554s1c1
Sequence:CCGGGTCTTGATGAACATCTGTGTACTCGAGTACACAGATGTTCATCAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007527
LMBRD2 MISSION shRNA shRNA Plasmid DNA
LMBR1 domain containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007527.1-1769s21c1
Sequence:CCGGGTGTTCAGGATTCGTGTATTTCTCGAGAAATACACGAATCCTGAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007527.1-2032s21c1
Sequence:CCGGTCTCTGCATTGCTACTTATTTCTCGAGAAATAAGTAGCAATGCAGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007527.1-2067s1c1
Sequence:CCGGGTTGTTTGAATCTGCTCGGTTCTCGAGAACCGAGCAGATTCAAACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007527.1-2357s1c1
Sequence:CCGGCGGATAGAACTTCTCCAAGATCTCGAGATCTTGGAGAAGTTCTATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007527.1-2789s1c1
Sequence:CCGGGCAGTTCAGTTTGTTTCAGATCTCGAGATCTGAAACAAACTGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007527.1-2572s1c1
Sequence:CCGGGTACCCTAGAATTTCCTCTATCTCGAGATAGAGGAAATTCTAGGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007527.1-3008s1c1
Sequence:CCGGCAAGGCTTACTTACTAGACATCTCGAGATGTCTAGTAAGTAAGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007527.1-2554s1c1
Sequence:CCGGGTCTTGATGAACATCTGTGTACTCGAGTACACAGATGTTCATCAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007527
LMBRD2 MISSION shRNA Lentiviral Transduction Particles
LMBR1 domain containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007527.1-1769s21c1
Sequence:CCGGGTGTTCAGGATTCGTGTATTTCTCGAGAAATACACGAATCCTGAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007527.1-2032s21c1
Sequence:CCGGTCTCTGCATTGCTACTTATTTCTCGAGAAATAAGTAGCAATGCAGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007527.1-2067s1c1
Sequence:CCGGGTTGTTTGAATCTGCTCGGTTCTCGAGAACCGAGCAGATTCAAACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007527.1-2357s1c1
Sequence:CCGGCGGATAGAACTTCTCCAAGATCTCGAGATCTTGGAGAAGTTCTATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007527.1-2789s1c1
Sequence:CCGGGCAGTTCAGTTTGTTTCAGATCTCGAGATCTGAAACAAACTGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007527.1-2572s1c1
Sequence:CCGGGTACCCTAGAATTTCCTCTATCTCGAGATAGAGGAAATTCTAGGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007527.1-3008s1c1
Sequence:CCGGCAAGGCTTACTTACTAGACATCTCGAGATGTCTAGTAAGTAAGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007527.1-2554s1c1
Sequence:CCGGGTCTTGATGAACATCTGTGTACTCGAGTACACAGATGTTCATCAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177178
LMBRD2 MISSION shRNA Bacterial Glycerol Stock
LMBR1 domain containing 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000182810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177178.3-288s1c1
Sequence:CCGGCTGCATCGCTATGGAGACTTTCTCGAGAAAGTCTCCATAGCGATGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177178.3-2586s1c1
Sequence:CCGGGCTAACTTGGTTTCATGCTAACTCGAGTTAGCATGAAACCAAGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177178.3-692s1c1
Sequence:CCGGCGGCACTTACTTGCTGATATTCTCGAGAATATCAGCAAGTAAGTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177178.3-1025s1c1
Sequence:CCGGGTGTGTAGACACAATACTTAACTCGAGTTAAGTATTGTGTCTACACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177178
LMBRD2 MISSION shRNA shRNA Plasmid DNA
LMBR1 domain containing 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000182810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177178.3-288s1c1
Sequence:CCGGCTGCATCGCTATGGAGACTTTCTCGAGAAAGTCTCCATAGCGATGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177178.3-2586s1c1
Sequence:CCGGGCTAACTTGGTTTCATGCTAACTCGAGTTAGCATGAAACCAAGTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177178.3-692s1c1
Sequence:CCGGCGGCACTTACTTGCTGATATTCTCGAGAATATCAGCAAGTAAGTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177178.3-1025s1c1
Sequence:CCGGGTGTGTAGACACAATACTTAACTCGAGTTAAGTATTGTGTCTACACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177178
LMBRD2 MISSION shRNA Lentiviral Transduction Particles
LMBR1 domain containing 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000182810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177178.3-288s1c1
Sequence:CCGGCTGCATCGCTATGGAGACTTTCTCGAGAAAGTCTCCATAGCGATGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177178.3-2586s1c1
Sequence:CCGGGCTAACTTGGTTTCATGCTAACTCGAGTTAGCATGAAACCAAGTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177178.3-692s1c1
Sequence:CCGGCGGCACTTACTTGCTGATATTCTCGAGAATATCAGCAAGTAAGTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177178.3-1025s1c1
Sequence:CCGGGTGTGTAGACACAATACTTAACTCGAGTTAAGTATTGTGTCTACACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)