EMAIL THIS PAGE TO A FRIEND

LMF1

lipase maturation factor 1

53 Gene Product Result for
Synonyms: C16orf26 HMFN1876 JFP11 TMEM112 TMEM112A
UniProtKB ID: Q96S06, Q68CJ3, Q96FJ4, Q9H6G4, Q9H9K7
Gene ID:
Human(64788) Summary: The protein encoded by this gene resides in the endoplasmic reticulum, and is involved in the maturation and transport of lipoprotein lipase through the secretory pathway. Mutations in this gene are associated with combined lipase deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2010]
Mouse(76483) lipase maturation factor 1
Rat(360495) lipase maturation factor 1
chicken(416528) lipase maturation factor 1
domestic cat(101090827) lipase maturation factor 1
cow(505124) lipase maturation factor 1
dog(490083) lipase maturation factor 1
sheep(101105873) lipase maturation factor 1
domestic guinea pig(100723218) lipase maturation factor 1
naked mole-rat(101710352) lipase maturation factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022773 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022773 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022773 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029624 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029624 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029624 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022773 Rosetta Predictions human pricing
XM_001060521 Rosetta Predictions rat pricing
XM_340769 Rosetta Predictions rat pricing
NM_029624 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191277 predicted 2023
2 SASI_Hs01_00191278 predicted 702
3 SASI_Hs01_00191279 predicted 1537
4 SASI_Hs02_00356065 predicted 740
5 SASI_Hs01_00191281 predicted 1594
6 SASI_Hs02_00356066 predicted 1249
7 SASI_Hs01_00191280 predicted 401
8 SASI_Hs01_00191282 predicted 497
9 SASI_Hs01_00191284 predicted 475
10 SASI_Hs01_00191285 predicted 464
11 SASI_Hs01_00191276 predicted 747
12 SASI_Hs01_00191283 predicted 2019
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060521 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296812 predicted 270
2 SASI_Rn02_00296813 predicted 548
3 SASI_Rn02_00296814 predicted 1713
4 SASI_Rn02_00296815 predicted 1182
5 SASI_Rn02_00296816 predicted 337
6 SASI_Rn02_00296817 predicted 1199
7 SASI_Rn02_00296818 predicted 1717
8 SASI_Rn02_00296819 predicted 331
9 SASI_Rn02_00296820 predicted 281
10 SASI_Rn02_00296821 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340769 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391869 predicted 270
2 SASI_Rn02_00391870 predicted 549
3 SASI_Rn02_00391871 predicted 1711
4 SASI_Rn02_00391872 predicted 1186
5 SASI_Rn02_00391873 predicted 345
6 SASI_Rn02_00391874 predicted 1202
7 SASI_Rn02_00391875 predicted 1717
8 SASI_Rn02_00391876 predicted 327
9 SASI_Rn02_00391877 predicted 274
10 SASI_Rn02_00391878 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029624 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064299 predicted 340
2 SASI_Mm01_00064300 predicted 1175
3 SASI_Mm01_00064301 predicted 1381
4 SASI_Mm01_00064302 predicted 1046
5 SASI_Mm01_00064303 predicted 771
6 SASI_Mm01_00064305 predicted 482
7 SASI_Mm01_00064306 predicted 1034
8 SASI_Mm01_00064307 predicted 289
9 SASI_Mm01_00064308 predicted 1063
10 SASI_Mm02_00335618 predicted 1032
11 SASI_Mm01_00064304 predicted 1056
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022773
LMF1 MISSION shRNA Bacterial Glycerol Stock
lipase maturation factor 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000438372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022773.2-497s21c1
Sequence:CCGGGGCCATGTCTGGTACTCTTTCCTCGAGGAAAGAGTACCAGACATGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022773.2-660s21c1
Sequence:CCGGTTGGAGCAGGCCTGATCAAGACTCGAGTCTTGATCAGGCCTGCTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022773.2-1202s21c1
Sequence:CCGGCTTCACATCGTCAACACTTACCTCGAGGTAAGTGTTGACGATGTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022773
LMF1 MISSION shRNA shRNA Plasmid DNA
lipase maturation factor 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000438372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022773.2-497s21c1
Sequence:CCGGGGCCATGTCTGGTACTCTTTCCTCGAGGAAAGAGTACCAGACATGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022773.2-660s21c1
Sequence:CCGGTTGGAGCAGGCCTGATCAAGACTCGAGTCTTGATCAGGCCTGCTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022773.2-1202s21c1
Sequence:CCGGCTTCACATCGTCAACACTTACCTCGAGGTAAGTGTTGACGATGTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022773
LMF1 MISSION shRNA Lentiviral Transduction Particles
lipase maturation factor 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000438372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022773.2-497s21c1
Sequence:CCGGGGCCATGTCTGGTACTCTTTCCTCGAGGAAAGAGTACCAGACATGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022773.2-660s21c1
Sequence:CCGGTTGGAGCAGGCCTGATCAAGACTCGAGTCTTGATCAGGCCTGCTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022773.2-1202s21c1
Sequence:CCGGCTTCACATCGTCAACACTTACCTCGAGGTAAGTGTTGACGATGTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029624
LMF1 MISSION shRNA Bacterial Glycerol Stock
lipase maturation factor 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029624.3-501s21c1
Sequence:CCGGACGTAGGGCAGATCTGGTATTCTCGAGAATACCAGATCTGCCCTACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029624.3-1051s21c1
Sequence:CCGGTCAGAGGGAAGATACACAAAGCTCGAGCTTTGTGTATCTTCCCTCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029624.3-335s21c1
Sequence:CCGGACCTATGCACCAACCATTATGCTCGAGCATAATGGTTGGTGCATAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029624.3-1628s21c1
Sequence:CCGGCGCAAGCGAATTGGTCCTTACCTCGAGGTAAGGACCAATTCGCTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029624.3-155s21c1
Sequence:CCGGACCTTCTGGCTGACTAGAATCCTCGAGGATTCTAGTCAGCCAGAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029624.2-374s1c1
Sequence:CCGGCTGGTCAGACATGAACTTCAACTCGAGTTGAAGTTCATGTCTGACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029624.2-1168s1c1
Sequence:CCGGCCGTGGTTATCAATCTGCTAACTCGAGTTAGCAGATTGATAACCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029624.2-1224s1c1
Sequence:CCGGCTCAGGATCGTCAACACCTATCTCGAGATAGGTGTTGACGATCCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029624.2-1196s1c1
Sequence:CCGGGCAGATCATGAACACCTCCTTCTCGAGAAGGAGGTGTTCATGATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029624
LMF1 MISSION shRNA shRNA Plasmid DNA
lipase maturation factor 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029624.3-501s21c1
Sequence:CCGGACGTAGGGCAGATCTGGTATTCTCGAGAATACCAGATCTGCCCTACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029624.3-1051s21c1
Sequence:CCGGTCAGAGGGAAGATACACAAAGCTCGAGCTTTGTGTATCTTCCCTCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029624.3-335s21c1
Sequence:CCGGACCTATGCACCAACCATTATGCTCGAGCATAATGGTTGGTGCATAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029624.3-1628s21c1
Sequence:CCGGCGCAAGCGAATTGGTCCTTACCTCGAGGTAAGGACCAATTCGCTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029624.3-155s21c1
Sequence:CCGGACCTTCTGGCTGACTAGAATCCTCGAGGATTCTAGTCAGCCAGAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029624.2-374s1c1
Sequence:CCGGCTGGTCAGACATGAACTTCAACTCGAGTTGAAGTTCATGTCTGACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029624.2-1168s1c1
Sequence:CCGGCCGTGGTTATCAATCTGCTAACTCGAGTTAGCAGATTGATAACCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029624.2-1224s1c1
Sequence:CCGGCTCAGGATCGTCAACACCTATCTCGAGATAGGTGTTGACGATCCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029624.2-1196s1c1
Sequence:CCGGGCAGATCATGAACACCTCCTTCTCGAGAAGGAGGTGTTCATGATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029624
LMF1 MISSION shRNA Lentiviral Transduction Particles
lipase maturation factor 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029624.3-501s21c1
Sequence:CCGGACGTAGGGCAGATCTGGTATTCTCGAGAATACCAGATCTGCCCTACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029624.3-1051s21c1
Sequence:CCGGTCAGAGGGAAGATACACAAAGCTCGAGCTTTGTGTATCTTCCCTCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029624.3-335s21c1
Sequence:CCGGACCTATGCACCAACCATTATGCTCGAGCATAATGGTTGGTGCATAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029624.3-1628s21c1
Sequence:CCGGCGCAAGCGAATTGGTCCTTACCTCGAGGTAAGGACCAATTCGCTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029624.3-155s21c1
Sequence:CCGGACCTTCTGGCTGACTAGAATCCTCGAGGATTCTAGTCAGCCAGAAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029624.2-374s1c1
Sequence:CCGGCTGGTCAGACATGAACTTCAACTCGAGTTGAAGTTCATGTCTGACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029624.2-1168s1c1
Sequence:CCGGCCGTGGTTATCAATCTGCTAACTCGAGTTAGCAGATTGATAACCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029624.2-1224s1c1
Sequence:CCGGCTCAGGATCGTCAACACCTATCTCGAGATAGGTGTTGACGATCCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029624.2-1196s1c1
Sequence:CCGGGCAGATCATGAACACCTCCTTCTCGAGAAGGAGGTGTTCATGATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)