EMAIL THIS PAGE TO A FRIEND

LMF2

lipase maturation factor 2

46 Gene Product Result for
Synonyms: TMEM112B TMEM153
UniProtKB ID: Q9BU23, A6NEZ0, Q13392, Q6ZNR2, Q8WU74, Q96C62
Gene ID:
Mouse(105847) lipase maturation factor 2
Rat(315218) lipase maturation factor 2
domestic guinea pig(100719365) lipase maturation factor 2
naked mole-rat(101700025) lipase maturation factor 2
sheep(101117495) lipase maturation factor 2
chicken(429380) lipase maturation factor 2
cow(510646) lipase maturation factor 2
domestic cat(101082168) lipase maturation factor 2
Horse(100056627) lipase maturation factor 2
dog(481188) lipase maturation factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033200 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033200 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033200 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178919 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178919 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178919 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033200 Rosetta Predictions human pricing
NM_001079939 Rosetta Predictions rat pricing
NM_178919 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010021 predicted 912
2 SASI_Hs01_00010022 predicted 1689
3 SASI_Hs01_00010023 predicted 1531
4 SASI_Hs01_00010024 predicted 1178
5 SASI_Hs01_00010025 predicted 1090
6 SASI_Hs01_00010026 predicted 2429
7 SASI_Hs01_00010027 predicted 1070
8 SASI_Hs01_00010028 predicted 895
9 SASI_Hs01_00010029 predicted 2200
10 SASI_Hs01_00010030 predicted 1730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079939 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208339 predicted 1887
2 SASI_Rn02_00208340 predicted 1580
3 SASI_Rn02_00208341 predicted 2272
4 SASI_Rn02_00208342 predicted 965
5 SASI_Rn02_00208343 predicted 258
6 SASI_Rn02_00208344 predicted 932
7 SASI_Rn02_00208345 predicted 1817
8 SASI_Rn02_00208346 predicted 1030
9 SASI_Rn02_00208347 predicted 926
10 SASI_Rn02_00208348 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178919 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072198 predicted 1273
2 SASI_Mm01_00072199 predicted 1466
3 SASI_Mm01_00072200 predicted 798
4 SASI_Mm01_00072201 predicted 785
5 SASI_Mm02_00349545 predicted 790
6 SASI_Mm01_00072202 predicted 1711
7 SASI_Mm01_00072203 predicted 1269
8 SASI_Mm01_00072205 predicted 1633
9 SASI_Mm01_00072206 predicted 829
10 SASI_Mm02_00349546 predicted 1471
11 SASI_Mm01_00072197 predicted 1774
12 SASI_Mm01_00072204 predicted 864
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033200
LMF2 MISSION shRNA Bacterial Glycerol Stock
lipase maturation factor 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033200.2-1069s21c1
Sequence:CCGGCCACTCCAGAACCACTTTCACCTCGAGGTGAAAGTGGTTCTGGAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033200.2-1218s21c1
Sequence:CCGGAGCTCAGTGCTGTAGTCCAACCTCGAGGTTGGACTACAGCACTGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033200.2-2142s21c1
Sequence:CCGGGGCGAAAGAAGTAGCTGTGTTCTCGAGAACACAGCTACTTCTTTCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033200.2-100s21c1
Sequence:CCGGCGCTTCCCTCTACACGCAAATCTCGAGATTTGCGTGTAGAGGGAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033200.2-1275s21c1
Sequence:CCGGTGATTAGCCTGGTGCCGTACTCTCGAGAGTACGGCACCAGGCTAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033200
LMF2 MISSION shRNA shRNA Plasmid DNA
lipase maturation factor 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033200.2-1069s21c1
Sequence:CCGGCCACTCCAGAACCACTTTCACCTCGAGGTGAAAGTGGTTCTGGAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033200.2-1218s21c1
Sequence:CCGGAGCTCAGTGCTGTAGTCCAACCTCGAGGTTGGACTACAGCACTGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033200.2-2142s21c1
Sequence:CCGGGGCGAAAGAAGTAGCTGTGTTCTCGAGAACACAGCTACTTCTTTCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033200.2-100s21c1
Sequence:CCGGCGCTTCCCTCTACACGCAAATCTCGAGATTTGCGTGTAGAGGGAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033200.2-1275s21c1
Sequence:CCGGTGATTAGCCTGGTGCCGTACTCTCGAGAGTACGGCACCAGGCTAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033200
LMF2 MISSION shRNA Lentiviral Transduction Particles
lipase maturation factor 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033200.2-1069s21c1
Sequence:CCGGCCACTCCAGAACCACTTTCACCTCGAGGTGAAAGTGGTTCTGGAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033200.2-1218s21c1
Sequence:CCGGAGCTCAGTGCTGTAGTCCAACCTCGAGGTTGGACTACAGCACTGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033200.2-2142s21c1
Sequence:CCGGGGCGAAAGAAGTAGCTGTGTTCTCGAGAACACAGCTACTTCTTTCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033200.2-100s21c1
Sequence:CCGGCGCTTCCCTCTACACGCAAATCTCGAGATTTGCGTGTAGAGGGAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033200.2-1275s21c1
Sequence:CCGGTGATTAGCCTGGTGCCGTACTCTCGAGAGTACGGCACCAGGCTAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178919
VALIDATED
LMF2 MISSION shRNA Bacterial Glycerol Stock
lipase maturation factor 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178919.2-2558s1c1
Sequence:CCGGCCCTCAGACTGTACCAATAAACTCGAGTTTATTGGTACAGTCTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178919.3-794s1c1
Sequence:CCGGCTTCTACGCTCAGGCATTATTCTCGAGAATAATGCCTGAGCGTAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178919.3-1018s21c1
Sequence:CCGGACGGCACTGTCTACTACTTTGCTCGAGCAAAGTAGTAGACAGTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178919.3-625s21c1
Sequence:CCGGCTGCTCTGACCTACCACTATGCTCGAGCATAGTGGTAGGTCAGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178919.3-794s21c1
Sequence:CCGGCTTCTACGCTCAGGCATTATTCTCGAGAATAATGCCTGAGCGTAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178919.3-2558s21c1
Sequence:CCGGCCTCAGACTGTACCAATAAAGCTCGAGCTTTATTGGTACAGTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178919.2-1827s1c1
Sequence:CCGGGCTCCAACAGTTTGGACTAAACTCGAGTTTAGTCCAAACTGTTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178919.3-430s21c1
Sequence:CCGGAGACTGGCTTCCTAGCTATACCTCGAGGTATAGCTAGGAAGCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178919
VALIDATED
LMF2 MISSION shRNA shRNA Plasmid DNA
lipase maturation factor 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178919.2-2558s1c1
Sequence:CCGGCCCTCAGACTGTACCAATAAACTCGAGTTTATTGGTACAGTCTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178919.3-794s1c1
Sequence:CCGGCTTCTACGCTCAGGCATTATTCTCGAGAATAATGCCTGAGCGTAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178919.3-1018s21c1
Sequence:CCGGACGGCACTGTCTACTACTTTGCTCGAGCAAAGTAGTAGACAGTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178919.3-625s21c1
Sequence:CCGGCTGCTCTGACCTACCACTATGCTCGAGCATAGTGGTAGGTCAGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178919.3-794s21c1
Sequence:CCGGCTTCTACGCTCAGGCATTATTCTCGAGAATAATGCCTGAGCGTAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178919.3-2558s21c1
Sequence:CCGGCCTCAGACTGTACCAATAAAGCTCGAGCTTTATTGGTACAGTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178919.2-1827s1c1
Sequence:CCGGGCTCCAACAGTTTGGACTAAACTCGAGTTTAGTCCAAACTGTTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178919.3-430s21c1
Sequence:CCGGAGACTGGCTTCCTAGCTATACCTCGAGGTATAGCTAGGAAGCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178919
VALIDATED
LMF2 MISSION shRNA Lentiviral Transduction Particles
lipase maturation factor 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178919.2-2558s1c1
Sequence:CCGGCCCTCAGACTGTACCAATAAACTCGAGTTTATTGGTACAGTCTGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178919.3-794s1c1
Sequence:CCGGCTTCTACGCTCAGGCATTATTCTCGAGAATAATGCCTGAGCGTAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178919.3-1018s21c1
Sequence:CCGGACGGCACTGTCTACTACTTTGCTCGAGCAAAGTAGTAGACAGTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178919.3-625s21c1
Sequence:CCGGCTGCTCTGACCTACCACTATGCTCGAGCATAGTGGTAGGTCAGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178919.3-794s21c1
Sequence:CCGGCTTCTACGCTCAGGCATTATTCTCGAGAATAATGCCTGAGCGTAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178919.3-2558s21c1
Sequence:CCGGCCTCAGACTGTACCAATAAAGCTCGAGCTTTATTGGTACAGTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178919.2-1827s1c1
Sequence:CCGGGCTCCAACAGTTTGGACTAAACTCGAGTTTAGTCCAAACTGTTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178919.3-430s21c1
Sequence:CCGGAGACTGGCTTCCTAGCTATACCTCGAGGTATAGCTAGGAAGCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)