EMAIL THIS PAGE TO A FRIEND

LMLN

leishmanolysin-like (metallopeptidase M8 family)

64 Gene Product Result for
Synonyms: GP63 INV IX14 MSP
UniProtKB ID: Q96KR4, B3LDG9, B3LDH0, C9J796, F8WB28, Q96KR5
Gene ID:
Human(89782) Summary: This gene encodes a zinc-metallopeptidase. The encoded protein may play a role in cell migration and invasion. Studies of a similar protein in Drosophila indicate a potential role in mitotic progression. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Mouse(239833) leishmanolysin-like (metallopeptidase M8 family)
Rat(363795) leishmanolysin-like (metallopeptidase M8 family)
chicken(424264) leishmanolysin-like (metallopeptidase M8 family)
domestic cat(101096910) leishmanolysin-like (metallopeptidase M8 family)
cow(532564) leishmanolysin-like (metallopeptidase M8 family)
cow(100337404) leishmanolysin-like (metallopeptidase M8 family)
Horse(100070217) leishmanolysin-like (metallopeptidase M8 family)
dog(609201) leishmanolysin-like (metallopeptidase M8 family)
sheep(101118237) leishmanolysin-like (metallopeptidase M8 family)
Domestic Rabbit(100343736) leishmanolysin-like (metallopeptidase M8 family)
domestic guinea pig(100717307) leishmanolysin-like (metallopeptidase M8 family)
naked mole-rat(101726660) leishmanolysin-like (metallopeptidase M8 family)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033029 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033029 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033029 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172823 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172823 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172823 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU015511 MISSION® esiRNA esiRNA targeting mouse Lmln (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033029 Rosetta Predictions human pricing
NM_001108843 Rosetta Predictions rat pricing
NM_172823 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187516 predicted 1576
2 SASI_Hs01_00187517 predicted 1573
3 SASI_Hs01_00187518 predicted 298
4 SASI_Hs02_00360718 predicted 436
5 SASI_Hs01_00187519 predicted 761
6 SASI_Hs01_00187520 predicted 384
7 SASI_Hs01_00187521 predicted 1218
8 SASI_Hs01_00187522 predicted 355
9 SASI_Hs01_00187523 predicted 749
10 SASI_Hs02_00360719 predicted 1998
11 SASI_Hs01_00187524 predicted 1370
12 SASI_Hs01_00187525 predicted 1712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108843 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242625 predicted 1375
2 SASI_Rn02_00242626 predicted 1386
3 SASI_Rn02_00242627 predicted 1227
4 SASI_Rn02_00242628 predicted 689
5 SASI_Rn02_00242629 predicted 1306
6 SASI_Rn02_00242630 predicted 478
7 SASI_Rn02_00242631 predicted 815
8 SASI_Rn02_00242632 predicted 1766
9 SASI_Rn02_00242633 predicted 580
10 SASI_Rn02_00242634 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061396 predicted 1235
2 SASI_Mm01_00061397 predicted 1301
3 SASI_Mm02_00344749 predicted 1560
4 SASI_Mm01_00061398 predicted 1151
5 SASI_Mm01_00061399 predicted 404
6 SASI_Mm01_00061400 predicted 739
7 SASI_Mm01_00061401 predicted 1315
8 SASI_Mm01_00061402 predicted 1564
9 SASI_Mm01_00061403 predicted 923
10 SASI_Mm01_00061404 predicted 2107
11 SASI_Mm01_00061405 predicted 1782
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033029
VALIDATED
LMLN MISSION shRNA Bacterial Glycerol Stock
leishmanolysin-like (metallopeptidase M8 family)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033029.3-449s21c1
Sequence:CCGGAGCAGACAATGTGCAACAAACCTCGAGGTTTGTTGCACATTGTCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033029.3-2067s21c1
Sequence:CCGGCAACCTATGCAGATGGTAGAACTCGAGTTCTACCATCTGCATAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033029.3-2118s21c1
Sequence:CCGGTGACGACCATCAGACCTTGAACTCGAGTTCAAGGTCTGATGGTCGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033029.3-1584s21c1
Sequence:CCGGCTCATTCCGTTTGTCTAATTCCTCGAGGAATTAGACAAACGGAATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033029.3-1222s21c1
Sequence:CCGGTCGAATCACTCTGGCATTAATCTCGAGATTAATGCCAGAGTGATTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033029.3-766s21c1
Sequence:CCGGTGCTAACCTGTGTCCAAATATCTCGAGATATTTGGACACAGGTTAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033029.1-1339s1c1
Sequence:CCGGCGTGTGTAATTTGCAGAAGTTCTCGAGAACTTCTGCAAATTACACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033029.1-825s1c1
Sequence:CCGGCCACAGTGAAACATGAGGTTACTCGAGTAACCTCATGTTTCACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_033029.1-1415s1c1
Sequence:CCGGGCAGAAGATTTGCCTTATTATCTCGAGATAATAAGGCAAATCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033029.1-1665s1c1
Sequence:CCGGGCGGATGCTATCAGGTTTCTTCTCGAGAAGAAACCTGATAGCATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033029
VALIDATED
LMLN MISSION shRNA shRNA Plasmid DNA
leishmanolysin-like (metallopeptidase M8 family)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033029.3-449s21c1
Sequence:CCGGAGCAGACAATGTGCAACAAACCTCGAGGTTTGTTGCACATTGTCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033029.3-2067s21c1
Sequence:CCGGCAACCTATGCAGATGGTAGAACTCGAGTTCTACCATCTGCATAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033029.3-2118s21c1
Sequence:CCGGTGACGACCATCAGACCTTGAACTCGAGTTCAAGGTCTGATGGTCGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033029.3-1584s21c1
Sequence:CCGGCTCATTCCGTTTGTCTAATTCCTCGAGGAATTAGACAAACGGAATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033029.3-1222s21c1
Sequence:CCGGTCGAATCACTCTGGCATTAATCTCGAGATTAATGCCAGAGTGATTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033029.3-766s21c1
Sequence:CCGGTGCTAACCTGTGTCCAAATATCTCGAGATATTTGGACACAGGTTAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033029.1-1339s1c1
Sequence:CCGGCGTGTGTAATTTGCAGAAGTTCTCGAGAACTTCTGCAAATTACACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033029.1-825s1c1
Sequence:CCGGCCACAGTGAAACATGAGGTTACTCGAGTAACCTCATGTTTCACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_033029.1-1415s1c1
Sequence:CCGGGCAGAAGATTTGCCTTATTATCTCGAGATAATAAGGCAAATCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033029.1-1665s1c1
Sequence:CCGGGCGGATGCTATCAGGTTTCTTCTCGAGAAGAAACCTGATAGCATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033029
VALIDATED
LMLN MISSION shRNA Lentiviral Transduction Particles
leishmanolysin-like (metallopeptidase M8 family)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033029.3-449s21c1
Sequence:CCGGAGCAGACAATGTGCAACAAACCTCGAGGTTTGTTGCACATTGTCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033029.3-2067s21c1
Sequence:CCGGCAACCTATGCAGATGGTAGAACTCGAGTTCTACCATCTGCATAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033029.3-2118s21c1
Sequence:CCGGTGACGACCATCAGACCTTGAACTCGAGTTCAAGGTCTGATGGTCGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033029.3-1584s21c1
Sequence:CCGGCTCATTCCGTTTGTCTAATTCCTCGAGGAATTAGACAAACGGAATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033029.3-1222s21c1
Sequence:CCGGTCGAATCACTCTGGCATTAATCTCGAGATTAATGCCAGAGTGATTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033029.3-766s21c1
Sequence:CCGGTGCTAACCTGTGTCCAAATATCTCGAGATATTTGGACACAGGTTAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033029.1-1339s1c1
Sequence:CCGGCGTGTGTAATTTGCAGAAGTTCTCGAGAACTTCTGCAAATTACACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033029.1-825s1c1
Sequence:CCGGCCACAGTGAAACATGAGGTTACTCGAGTAACCTCATGTTTCACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_033029.1-1415s1c1
Sequence:CCGGGCAGAAGATTTGCCTTATTATCTCGAGATAATAAGGCAAATCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033029.1-1665s1c1
Sequence:CCGGGCGGATGCTATCAGGTTTCTTCTCGAGAAGAAACCTGATAGCATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172823
LMLN MISSION shRNA Bacterial Glycerol Stock
leishmanolysin-like (metallopeptidase M8 family)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172823.1-1570s1c1
Sequence:CCGGGCTGGCATTTAAGTGGCGAATCTCGAGATTCGCCACTTAAATGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172823.1-1603s1c1
Sequence:CCGGCCGACTGTAGAATCCTGGAAACTCGAGTTTCCAGGATTCTACAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172823.1-909s1c1
Sequence:CCGGCCGCCCTTCAACTATAGTCTTCTCGAGAAGACTATAGTTGAAGGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172823.1-205s1c1
Sequence:CCGGCGGACACTGAGGTCATAAATACTCGAGTATTTATGACCTCAGTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172823.1-931s1c1
Sequence:CCGGGCTTGTATCAGTGGAGTGATACTCGAGTATCACTCCACTGATACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172823
LMLN MISSION shRNA shRNA Plasmid DNA
leishmanolysin-like (metallopeptidase M8 family)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172823.1-1570s1c1
Sequence:CCGGGCTGGCATTTAAGTGGCGAATCTCGAGATTCGCCACTTAAATGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172823.1-1603s1c1
Sequence:CCGGCCGACTGTAGAATCCTGGAAACTCGAGTTTCCAGGATTCTACAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172823.1-909s1c1
Sequence:CCGGCCGCCCTTCAACTATAGTCTTCTCGAGAAGACTATAGTTGAAGGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172823.1-205s1c1
Sequence:CCGGCGGACACTGAGGTCATAAATACTCGAGTATTTATGACCTCAGTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172823.1-931s1c1
Sequence:CCGGGCTTGTATCAGTGGAGTGATACTCGAGTATCACTCCACTGATACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172823
LMLN MISSION shRNA Lentiviral Transduction Particles
leishmanolysin-like (metallopeptidase M8 family)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172823.1-1570s1c1
Sequence:CCGGGCTGGCATTTAAGTGGCGAATCTCGAGATTCGCCACTTAAATGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172823.1-1603s1c1
Sequence:CCGGCCGACTGTAGAATCCTGGAAACTCGAGTTTCCAGGATTCTACAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172823.1-909s1c1
Sequence:CCGGCCGCCCTTCAACTATAGTCTTCTCGAGAAGACTATAGTTGAAGGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172823.1-205s1c1
Sequence:CCGGCGGACACTGAGGTCATAAATACTCGAGTATTTATGACCTCAGTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172823.1-931s1c1
Sequence:CCGGGCTTGTATCAGTGGAGTGATACTCGAGTATCACTCCACTGATACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)