EMAIL THIS PAGE TO A FRIEND

LMNA

lamin A/C

259 Gene Product Result for
Synonyms: CDCD1 CDDC CMD1A CMT2B1 EMD2 FPL FPLD FPLD2 HGPS IDC LDP1 LFP LGMD1B LMN1 LMNC LMNL1 PRO1
Gene ID:
Human(4000) Summary: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Alternative splicing results in multiple transcript variants. Mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome. [provided by RefSeq, Apr 2012]
Mouse(16905) lamin A
Rat(60374) lamin A/C
cow(404144) lamin A/C
Horse(100057663) lamin A/C
dog(480124) lamin A/C
chicken(415464) lamin A/C
sheep(101107924) lamin A/C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
L1293 Anti-Lamin A (C-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat, mouse
immunofluorescence, western blot pricing
SAB4501766 Anti-Lamin A (Cleaved-Asp230) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4501767 Anti-Lamin A (Cleaved-Asp230) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4501764 Anti-Lamin A antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501765 Anti-Lamin A antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
L3544 Anti-Lamin A−Atto 647N antibody produced in rabbit 1.5-3 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence pricing
GW21155 Anti-LMNA antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, human, mouse
western blot pricing
SAB1406087 Anti-LMNA antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA006660 Anti-LMNA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation rat, human, mouse
immunohistochemistry, western blot pricing
SAB4504744 Anti-phospho-Lamin A (pSer22) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4503932 Anti-phospho-Lamin A/C (pSer392) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4200420 Monoclonal Anti-Lamin A, mature antibody produced in mouse ~1.0 mg/mL, clone 4A4, purified immunoglobulin human
immunofluorescence, western blot pricing
SAB4200236 Monoclonal Anti-Lamin A/C antibody produced in mouse clone 4C11, purified from hybridoma cell culture human, rat, canine, hamster, mouse, bovine, monkey
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB4200421 Monoclonal Anti-Lamin A/C R453W antibody produced in mouse ~1.0 mg/mL, clone 12A-2F5, purified immunoglobulin human
western blot pricing
SAB4200422 Monoclonal Anti-Lamin A/C R482W antibody produced in mouse ~1.0 mg/mL, clone 5H8-B4, purified immunoglobulin human
western blot pricing
SAB4200272 Monoclonal Anti-Progerin antibody produced in mouse ~1.0 mg/mL, clone 13A4, purified immunoglobulin human
immunofluorescence, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002011 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001002011 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001002011 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_170707 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170707 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170707 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
MABT545 Anti-Lamin A and C Antibody, clone 2F4.1 Anti-Lamin A and C, clone 2F4.1, Cat. No. MABT545,is a mouse monoclonal antibody that detects Lamin A/C and has been tested for use in Immunohistochemistry (Paraffin) and Western Blotting. pricing
MAB3540 Anti-Lamin A Antibody, CT, a.a. 598-611, clone 133A2 This Anti-Lamin A Antibody, C-terminus, a.a. 598-611, clone 133A2 is validated for use in FC, WB, IC, IH for the detection of Lamin A. pricing
05-714 Anti-Lamin A/C Antibody, clone 14 Anti-Lamin A/C Antibody, clone 14 detects level of Lamin A/C & has been published & validated for use in IC & WB. pricing
MABT1340 Anti-Lamin A/C Antibody, clone 2A1 Anti-Lamin A/C, clone 2A1, Cat. No. MABT1340, is a highly specific mouse monoclonal antibody that targets Lamin A/C and has been tested for use in Immunocytochemistry, Immunofluorescence, Immunoprecipitation, and Western Blotting. pricing
MABT538 Anti-Lamin A/C Antibody, clone 2E8.2 This mouse monoclonal Anti-Lamin A/C Antibody, clone 2E8.2, Cat. No. MABT538 is validated for use in Immunohistochemistry (Paraffin) and Western Blotting for the detection of lamin A/C. pricing
MABT538-AF488 Anti-Lamin A/C Antibody, clone 2E8.2 Antibody, Alexa Fluor® 488 Conjugate This mouse monoclonal Anti-Lamin A/C Antibody, clone 2E8.2, Alexa Fluor® 488 Conjugate, Cat. No. MABT538-AF488 is used for the detection of Lamin A/C by Immunocytochemistry. pricing
MAB3538 Anti-Lamin A/C Antibody, localized to aa319-566 rat lamin A, clone 131C3 Anti-Lamin A/C Antibody, localized to aa319-566 rat lamin A, clone 131C3 detects level of Lamin A/C & has been published & validated for use in FC, WB, IH. pricing
MABT330 Anti-Lamin A (mature) Antibody, clone 4A4-A4 Anti-Lamin A (mature), clone 4A4-A4 is an antibody against Lamin A (mature) for use in WB, IP, ICC. pricing
ABT1389 Anti-Phospho Lamin A/C (Ser22) Anti-Phospho Lamin A/C (Ser22), Cat. No. ABT1389 is a rabbit polyclonal antibody that detects LAmin A/C phosphorylated on Serine 22 and has been tested for use in Western Blotting and Peptide Inhibition Assay. pricing
ABT1388 Anti-Phospho-Lamin A/C (Ser390) Anti-Phospho-Lamin A/C (Ser390), Cat. No. ABT1388, is a rabbit polyclonal antibody that detects Lamin A/C phosphorylated on Serine 390 and has been tested for use in Western Blotting and Peptide Inhibition Assay. pricing
ABT1387 Anti-Phospho-Lamin A/C (Ser404) Anti-Phospho-Lamin A/C (Ser404), Cat. No. ABT1387, is a rabbit polyclonal antibody that detects Lamin A/C phosphorylated on Serine 404 and has been tested for use in Immunofluorescence, Western Blotting, and Peptide Inhibition Assay. pricing
MABT345 Anti-Prelamin-A Antibody, clone 7G11 This Anti-Prelamin-A Antibody, clone 7G11 is validated for use in Western Blotting and Immunofluorescence for the detection of Prelamin-A. pricing
MABT858 Anti-prelamin A Antibody, clone PL-1C7 Anti-prelamin A, clone PL-1C7, Cat. No. MABT858, is a mouse monoclonal antibody that detects Prelamin A and has been tested for use in ELISA, Flow Cytometry, Immunocytochemistry, and Western Blotting. pricing
05-1231 Anti-Progerin Antibody, clone 13A4 This Anti-Progerin Antibody, clone 13A4 is validated for use in WB, IC, ELISA, IP for the detection of Progerin. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005572 Rosetta Predictions human pricing
NM_170707 Rosetta Predictions human pricing
NM_170708 Rosetta Predictions human pricing
NM_001002016 Rosetta Predictions rat pricing
NM_001002011 Rosetta Predictions mouse pricing
NM_001111102 Rosetta Predictions mouse pricing
NM_019390 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339847 predicted 1516
2 SASI_Hs01_00100723 predicted 515
3 SASI_Hs01_00100724 predicted 1530
4 SASI_Hs01_00100726 predicted 371
5 SASI_Hs01_00100727 predicted 1281
6 SASI_Hs02_00339848 predicted 1065
7 SASI_Hs01_00100729 predicted 921
8 SASI_Hs02_00339849 predicted 1608
9 SASI_Hs02_00339850 predicted 620
10 SASI_Hs02_00339851 predicted 1358
11 SASI_Hs01_00100720 predicted 530
12 SASI_Hs01_00100721 predicted 556
13 SASI_Hs01_00100722 predicted 646
14 SASI_Hs01_00100725 predicted 1548
15 SASI_Hs01_00100728 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367643 predicted 1516
2 SASI_Hs01_00118549 predicted 518
3 SASI_Hs01_00118550 predicted 1529
4 SASI_Hs01_00118552 predicted 373
5 SASI_Hs01_00118553 predicted 1285
6 SASI_Hs02_00367644 predicted 1072
7 SASI_Hs01_00118555 predicted 917
8 SASI_Hs02_00367645 predicted 1612
9 SASI_Hs02_00367646 predicted 621
10 SASI_Hs02_00367647 predicted 1355
11 SASI_Hs01_00118546 predicted 531
12 SASI_Hs01_00118547 predicted 558
13 SASI_Hs01_00118548 predicted 653
14 SASI_Hs01_00118551 predicted 1545
15 SASI_Hs01_00118554 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367648 predicted 1515
2 SASI_Hs01_00064056 predicted 514
3 SASI_Hs01_00064057 predicted 1523
4 SASI_Hs01_00064059 predicted 367
5 SASI_Hs01_00064060 predicted 1277
6 SASI_Hs02_00367649 predicted 1074
7 SASI_Hs01_00064062 predicted 915
8 SASI_Hs02_00367650 predicted 1603
9 SASI_Hs02_00367651 predicted 621
10 SASI_Hs02_00367652 predicted 1362
11 SASI_Hs01_00064054 predicted 554
12 SASI_Hs01_00064055 predicted 646
13 SASI_Hs01_00064058 predicted 1546
14 SASI_Hs01_00064061 predicted 477
15 SASI_Hs01_00064053 positive 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096209 predicted 504
2 SASI_Rn01_00096210 positive 1583
3 SASI_Rn01_00096211 predicted 1793
4 SASI_Rn01_00096212 predicted 464
5 SASI_Rn01_00096213 predicted 488
6 SASI_Rn02_00197955 predicted 1018
7 SASI_Rn01_00096214 predicted 1608
8 SASI_Rn01_00096215 predicted 1224
9 SASI_Rn01_00096216 predicted 1232
10 SASI_Rn02_00197956 predicted 1796
11 SASI_Rn01_00096217 predicted 1697
12 SASI_Rn01_00096218 predicted 1279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002011 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084266 predicted 1547
2 SASI_Mm01_00084267 predicted 1673
3 SASI_Mm01_00084268 predicted 1642
4 SASI_Mm01_00084269 predicted 898
5 SASI_Mm01_00084270 predicted 981
6 SASI_Mm01_00084271 predicted 996
7 SASI_Mm01_00084272 predicted 832
8 SASI_Mm01_00084273 predicted 1096
9 SASI_Mm01_00084274 predicted 1338
10 SASI_Mm02_00286274 predicted 1032
11 SASI_Mm01_00084265 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306412 predicted 1545
2 SASI_Mm02_00306413 predicted 1674
3 SASI_Mm02_00306414 predicted 1643
4 SASI_Mm02_00306415 predicted 893
5 SASI_Mm02_00306416 predicted 978
6 SASI_Mm02_00306417 predicted 1002
7 SASI_Mm02_00306418 predicted 833
8 SASI_Mm02_00306419 predicted 1093
9 SASI_Mm02_00306420 predicted 1330
10 SASI_Mm02_00306421 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130235 predicted 1028
2 SASI_Mm01_00130236 predicted 1157
3 SASI_Mm01_00130237 predicted 1124
4 SASI_Mm01_00130238 predicted 372
5 SASI_Mm01_00130239 predicted 453
6 SASI_Mm01_00130240 predicted 474
7 SASI_Mm01_00130241 predicted 319
8 SASI_Mm01_00130242 predicted 573
9 SASI_Mm01_00130243 predicted 812
10 SASI_Mm02_00324312 predicted 511
11 SASI_Mm01_00130234 predicted 321
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002011
VALIDATED
LMNA MISSION shRNA Bacterial Glycerol Stock
lamin A/C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002011.2-901s21c1
Sequence:CCGGGCGGCTTGTGGAGATCGATAACTCGAGTTATCGATCTCCACAAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002011.2-1652s21c1
Sequence:CCGGGACGATCCTTTGATGACCTATCTCGAGATAGGTCATCAAAGGATCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002011.2-838s21c1
Sequence:CCGGGCTTGACTTCCAGAAGAACATCTCGAGATGTTCTTCTGGAAGTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002011.2-1679s21c1
Sequence:CCGGCCACCGAAGTTCACCCTAAAGCTCGAGCTTTAGGGTGAACTTCGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002011.2-2488s21c1
Sequence:CCGGTTTCCTTGTATCTGCCTTAAACTCGAGTTTAAGGCAGATACAAGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002011.1-1653s1c1
Sequence:CCGGCCCACCGAAGTTCACCCTAAACTCGAGTTTAGGGTGAACTTCGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002011.1-976s1c1
Sequence:CCGGCAGTATAAGAAGGAGCTAGAACTCGAGTTCTAGCTCCTTCTTATACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002011.1-1627s1c1
Sequence:CCGGGACGATCCTTTGATGACCTATCTCGAGATAGGTCATCAAAGGATCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002011.1-813s1c1
Sequence:CCGGGCTTGACTTCCAGAAGAACATCTCGAGATGTTCTTCTGGAAGTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002011.1-2460s1c1
Sequence:CCGGCTTTCCTTGTATCTGCCTTAACTCGAGTTAAGGCAGATACAAGGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002011
VALIDATED
LMNA MISSION shRNA shRNA Plasmid DNA
lamin A/C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002011.2-901s21c1
Sequence:CCGGGCGGCTTGTGGAGATCGATAACTCGAGTTATCGATCTCCACAAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002011.2-1652s21c1
Sequence:CCGGGACGATCCTTTGATGACCTATCTCGAGATAGGTCATCAAAGGATCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002011.2-838s21c1
Sequence:CCGGGCTTGACTTCCAGAAGAACATCTCGAGATGTTCTTCTGGAAGTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002011.2-1679s21c1
Sequence:CCGGCCACCGAAGTTCACCCTAAAGCTCGAGCTTTAGGGTGAACTTCGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002011.2-2488s21c1
Sequence:CCGGTTTCCTTGTATCTGCCTTAAACTCGAGTTTAAGGCAGATACAAGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002011.1-1653s1c1
Sequence:CCGGCCCACCGAAGTTCACCCTAAACTCGAGTTTAGGGTGAACTTCGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002011.1-976s1c1
Sequence:CCGGCAGTATAAGAAGGAGCTAGAACTCGAGTTCTAGCTCCTTCTTATACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002011.1-1627s1c1
Sequence:CCGGGACGATCCTTTGATGACCTATCTCGAGATAGGTCATCAAAGGATCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002011.1-813s1c1
Sequence:CCGGGCTTGACTTCCAGAAGAACATCTCGAGATGTTCTTCTGGAAGTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002011.1-2460s1c1
Sequence:CCGGCTTTCCTTGTATCTGCCTTAACTCGAGTTAAGGCAGATACAAGGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002011
VALIDATED
LMNA MISSION shRNA Lentiviral Transduction Particles
lamin A/C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002011.2-901s21c1
Sequence:CCGGGCGGCTTGTGGAGATCGATAACTCGAGTTATCGATCTCCACAAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002011.2-1652s21c1
Sequence:CCGGGACGATCCTTTGATGACCTATCTCGAGATAGGTCATCAAAGGATCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002011.2-838s21c1
Sequence:CCGGGCTTGACTTCCAGAAGAACATCTCGAGATGTTCTTCTGGAAGTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001002011.2-1679s21c1
Sequence:CCGGCCACCGAAGTTCACCCTAAAGCTCGAGCTTTAGGGTGAACTTCGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002011.2-2488s21c1
Sequence:CCGGTTTCCTTGTATCTGCCTTAAACTCGAGTTTAAGGCAGATACAAGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002011.1-1653s1c1
Sequence:CCGGCCCACCGAAGTTCACCCTAAACTCGAGTTTAGGGTGAACTTCGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002011.1-976s1c1
Sequence:CCGGCAGTATAAGAAGGAGCTAGAACTCGAGTTCTAGCTCCTTCTTATACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002011.1-1627s1c1
Sequence:CCGGGACGATCCTTTGATGACCTATCTCGAGATAGGTCATCAAAGGATCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001002011.1-813s1c1
Sequence:CCGGGCTTGACTTCCAGAAGAACATCTCGAGATGTTCTTCTGGAAGTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002011.1-2460s1c1
Sequence:CCGGCTTTCCTTGTATCTGCCTTAACTCGAGTTAAGGCAGATACAAGGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170707
VALIDATED
LMNA MISSION shRNA Bacterial Glycerol Stock
lamin A/C
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170707.2-2464s21c1
Sequence:CCGGCTCATCTATCTCAATCCTAATCTCGAGATTAGGATTGAGATAGATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_170707.2-1049s21c1
Sequence:CCGGATTCTGCCAAGCTGGACAATGCTCGAGCATTGTCCAGCTTGGCAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_170707.2-614s21c1
Sequence:CCGGAGAAGGAGGGTGACCTGATAGCTCGAGCTATCAGGTCACCCTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170707.2-1609s21c1
Sequence:CCGGCTGCGCAACAAGTCCAATGAGCTCGAGCTCATTGGACTTGTTGCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170707.2-365s21c1
Sequence:CCGGATGATCGCTTGGCGGTCTACACTCGAGTGTAGACCGCCAAGCGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170707.2-2942s21c1
Sequence:CCGGGGGAGAAGAAAGGTGAGTTTGCTCGAGCAAACTCACCTTTCTTCTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170707.2-1010s21c1
Sequence:CCGGACCAGGTGGAGCAGTATAAGACTCGAGTCTTATACTGCTCCACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_170707.1-885s1c1
Sequence:CCGGCGACTGGTGGAGATTGACAATCTCGAGATTGTCAATCTCCACCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_170707.1-752s1c1
Sequence:CCGGGAAGCAACTTCAGGATGAGATCTCGAGATCTCATCCTGAAGTTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170707.1-1661s1c1
Sequence:CCGGCCCACCAAAGTTCACCCTGAACTCGAGTTCAGGGTGAACTTTGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170707.1-1601s1c1
Sequence:CCGGCATGGGCAATTGGCAGATCAACTCGAGTTGATCTGCCAATTGCCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170707.1-1411s1c1
Sequence:CCGGGCCGTGCTTCCTCTCACTCATCTCGAGATGAGTGAGAGGAAGCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170707
VALIDATED
LMNA MISSION shRNA shRNA Plasmid DNA
lamin A/C
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170707.2-2464s21c1
Sequence:CCGGCTCATCTATCTCAATCCTAATCTCGAGATTAGGATTGAGATAGATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_170707.2-1049s21c1
Sequence:CCGGATTCTGCCAAGCTGGACAATGCTCGAGCATTGTCCAGCTTGGCAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_170707.2-614s21c1
Sequence:CCGGAGAAGGAGGGTGACCTGATAGCTCGAGCTATCAGGTCACCCTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170707.2-1609s21c1
Sequence:CCGGCTGCGCAACAAGTCCAATGAGCTCGAGCTCATTGGACTTGTTGCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170707.2-365s21c1
Sequence:CCGGATGATCGCTTGGCGGTCTACACTCGAGTGTAGACCGCCAAGCGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170707.2-2942s21c1
Sequence:CCGGGGGAGAAGAAAGGTGAGTTTGCTCGAGCAAACTCACCTTTCTTCTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170707.2-1010s21c1
Sequence:CCGGACCAGGTGGAGCAGTATAAGACTCGAGTCTTATACTGCTCCACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_170707.1-885s1c1
Sequence:CCGGCGACTGGTGGAGATTGACAATCTCGAGATTGTCAATCTCCACCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_170707.1-752s1c1
Sequence:CCGGGAAGCAACTTCAGGATGAGATCTCGAGATCTCATCCTGAAGTTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170707.1-1661s1c1
Sequence:CCGGCCCACCAAAGTTCACCCTGAACTCGAGTTCAGGGTGAACTTTGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170707.1-1601s1c1
Sequence:CCGGCATGGGCAATTGGCAGATCAACTCGAGTTGATCTGCCAATTGCCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170707.1-1411s1c1
Sequence:CCGGGCCGTGCTTCCTCTCACTCATCTCGAGATGAGTGAGAGGAAGCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170707
VALIDATED
LMNA MISSION shRNA Lentiviral Transduction Particles
lamin A/C
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170707.2-2464s21c1
Sequence:CCGGCTCATCTATCTCAATCCTAATCTCGAGATTAGGATTGAGATAGATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_170707.2-1049s21c1
Sequence:CCGGATTCTGCCAAGCTGGACAATGCTCGAGCATTGTCCAGCTTGGCAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_170707.2-614s21c1
Sequence:CCGGAGAAGGAGGGTGACCTGATAGCTCGAGCTATCAGGTCACCCTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170707.2-1609s21c1
Sequence:CCGGCTGCGCAACAAGTCCAATGAGCTCGAGCTCATTGGACTTGTTGCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170707.2-365s21c1
Sequence:CCGGATGATCGCTTGGCGGTCTACACTCGAGTGTAGACCGCCAAGCGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170707.2-2942s21c1
Sequence:CCGGGGGAGAAGAAAGGTGAGTTTGCTCGAGCAAACTCACCTTTCTTCTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170707.2-1010s21c1
Sequence:CCGGACCAGGTGGAGCAGTATAAGACTCGAGTCTTATACTGCTCCACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_170707.1-885s1c1
Sequence:CCGGCGACTGGTGGAGATTGACAATCTCGAGATTGTCAATCTCCACCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_170707.1-752s1c1
Sequence:CCGGGAAGCAACTTCAGGATGAGATCTCGAGATCTCATCCTGAAGTTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170707.1-1661s1c1
Sequence:CCGGCCCACCAAAGTTCACCCTGAACTCGAGTTCAGGGTGAACTTTGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170707.1-1601s1c1
Sequence:CCGGCATGGGCAATTGGCAGATCAACTCGAGTTGATCTGCCAATTGCCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170707.1-1411s1c1
Sequence:CCGGGCCGTGCTTCCTCTCACTCATCTCGAGATGAGTGAGAGGAAGCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)