EMAIL THIS PAGE TO A FRIEND

LMNB1

lamin B1

104 Gene Product Result for
Synonyms: ADLD LMN LMN2 LMNB
UniProtKB ID: P20700, B2R6J6, Q3SYN7, Q96EI6
Gene ID:
Human(4001) Summary: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. This gene encodes one of the two B type proteins, B1. Alternative splicing results in transcript variants and a duplication of this gene is associated with autosomal dominant adult-onset leukodystrophy (ADLD). [provided by RefSeq, Oct 2010]
Mouse(16906) lamin B1
Rat(116685) lamin B1
cow(540643) lamin B1
Horse(100073057) lamin B1
dog(474663) lamin B1
chicken(396223) lamin B1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306342 ANTI-LAMIN B1(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2502100 Anti-LMNB1 antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, human, pig
ELISA, western blot pricing
SAB2502101 Anti-LMNB1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, western blot pricing
SAB2101352 Anti-LMNB1 antibody produced in rabbit affinity isolated antibody rabbit, bovine, human, mouse, rat, guinea pig, horse
western blot pricing
SAB1410759 Anti-LMNB1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA050524 Anti-LMNB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA053579 Anti-LMNB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1400153 Monoclonal Anti-LMNB1 antibody produced in mouse clone 4B10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1404027 Monoclonal Anti-LMNB1 antibody produced in mouse clone 4E4, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AMAB91251 Monoclonal Anti-LMNB1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3929, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005573 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005573 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005573 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010721 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010721 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010721 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005573 Rosetta Predictions human pricing
NM_053905 Rosetta Predictions rat pricing
NM_010721 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203184 predicted 1056
2 SASI_Hs01_00203185 predicted 1239
3 SASI_Hs01_00203186 predicted 1496
4 SASI_Hs01_00203187 predicted 1800
5 SASI_Hs02_00339852 predicted 1290
6 SASI_Hs01_00203189 predicted 770
7 SASI_Hs01_00203191 predicted 1729
8 SASI_Hs02_00339853 predicted 1715
9 SASI_Hs01_00203192 predicted 1164
10 SASI_Hs01_00203193 predicted 1697
11 SASI_Hs01_00203188 predicted 1072
12 SASI_Hs01_00203190 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053905 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076309 predicted 1573
2 SASI_Rn01_00076310 predicted 1754
3 SASI_Rn02_00266835 predicted 1574
4 SASI_Rn01_00076312 predicted 1437
5 SASI_Rn01_00076313 predicted 728
6 SASI_Rn01_00076314 predicted 1654
7 SASI_Rn01_00076315 predicted 1272
8 SASI_Rn01_00076316 predicted 1669
9 SASI_Rn02_00266836 predicted 1240
10 SASI_Rn01_00076317 predicted 883
11 SASI_Rn01_00076311 predicted 1592
12 SASI_Rn01_00076318 predicted 1694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128916 predicted 1730
2 SASI_Mm01_00128917 predicted 1622
3 SASI_Mm01_00128918 predicted 1234
4 SASI_Mm01_00128919 predicted 1652
5 SASI_Mm01_00128920 predicted 784
6 SASI_Mm01_00128921 predicted 1233
7 SASI_Mm01_00128922 predicted 707
8 SASI_Mm01_00128924 predicted 1245
9 SASI_Mm01_00128925 predicted 1225
10 SASI_Mm02_00319194 predicted 1475
11 SASI_Mm01_00128923 predicted 1624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005573
VALIDATED
LMNB1 MISSION shRNA Bacterial Glycerol Stock
lamin B1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005573.2-1731s21c1
Sequence:CCGGCGCTTGAAGAACACTTCTGAACTCGAGTTCAGAAGTGTTCTTCAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005573.2-1986s21c1
Sequence:CCGGGCTCAAAGAAGTACAGTCTTTCTCGAGAAAGACTGTACTTCTTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005573.2-1234s21c1
Sequence:CCGGCCAGGGAAGAACTGATGGAAACTCGAGTTTCCATCAGTTCTTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005573.2-760s21c1
Sequence:CCGGCCCAGATCAAGCTTCGAGAATCTCGAGATTCTCGAAGCTTGATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005573.2-1258s21c1
Sequence:CCGGGCATGAGAATTGAGAGCCTTTCTCGAGAAAGGCTCTCAATTCTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005573.2-1234s1c1
Sequence:CCGGCCAGGGAAGAACTGATGGAAACTCGAGTTTCCATCAGTTCTTCCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005573.2-760s1c1
Sequence:CCGGCCCAGATCAAGCTTCGAGAATCTCGAGATTCTCGAAGCTTGATCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005573.2-1986s1c1
Sequence:CCGGGCTCAAAGAAGTACAGTCTTTCTCGAGAAAGACTGTACTTCTTTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005573.2-1731s1c1
Sequence:CCGGCGCTTGAAGAACACTTCTGAACTCGAGTTCAGAAGTGTTCTTCAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005573
VALIDATED
LMNB1 MISSION shRNA shRNA Plasmid DNA
lamin B1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005573.2-1731s21c1
Sequence:CCGGCGCTTGAAGAACACTTCTGAACTCGAGTTCAGAAGTGTTCTTCAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005573.2-1986s21c1
Sequence:CCGGGCTCAAAGAAGTACAGTCTTTCTCGAGAAAGACTGTACTTCTTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005573.2-1234s21c1
Sequence:CCGGCCAGGGAAGAACTGATGGAAACTCGAGTTTCCATCAGTTCTTCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005573.2-760s21c1
Sequence:CCGGCCCAGATCAAGCTTCGAGAATCTCGAGATTCTCGAAGCTTGATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005573.2-1258s21c1
Sequence:CCGGGCATGAGAATTGAGAGCCTTTCTCGAGAAAGGCTCTCAATTCTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005573.2-1234s1c1
Sequence:CCGGCCAGGGAAGAACTGATGGAAACTCGAGTTTCCATCAGTTCTTCCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005573.2-760s1c1
Sequence:CCGGCCCAGATCAAGCTTCGAGAATCTCGAGATTCTCGAAGCTTGATCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005573.2-1986s1c1
Sequence:CCGGGCTCAAAGAAGTACAGTCTTTCTCGAGAAAGACTGTACTTCTTTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005573.2-1731s1c1
Sequence:CCGGCGCTTGAAGAACACTTCTGAACTCGAGTTCAGAAGTGTTCTTCAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005573
VALIDATED
LMNB1 MISSION shRNA Lentiviral Transduction Particles
lamin B1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_005573.2-1731s21c1
Sequence:CCGGCGCTTGAAGAACACTTCTGAACTCGAGTTCAGAAGTGTTCTTCAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005573.2-1986s21c1
Sequence:CCGGGCTCAAAGAAGTACAGTCTTTCTCGAGAAAGACTGTACTTCTTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005573.2-1234s21c1
Sequence:CCGGCCAGGGAAGAACTGATGGAAACTCGAGTTTCCATCAGTTCTTCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005573.2-760s21c1
Sequence:CCGGCCCAGATCAAGCTTCGAGAATCTCGAGATTCTCGAAGCTTGATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005573.2-1258s21c1
Sequence:CCGGGCATGAGAATTGAGAGCCTTTCTCGAGAAAGGCTCTCAATTCTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005573.2-1234s1c1
Sequence:CCGGCCAGGGAAGAACTGATGGAAACTCGAGTTTCCATCAGTTCTTCCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005573.2-760s1c1
Sequence:CCGGCCCAGATCAAGCTTCGAGAATCTCGAGATTCTCGAAGCTTGATCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005573.2-1986s1c1
Sequence:CCGGGCTCAAAGAAGTACAGTCTTTCTCGAGAAAGACTGTACTTCTTTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005573.2-1731s1c1
Sequence:CCGGCGCTTGAAGAACACTTCTGAACTCGAGTTCAGAAGTGTTCTTCAAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010721
VALIDATED
LMNB1 MISSION shRNA Bacterial Glycerol Stock
lamin B1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010721.1-2140s1c1
Sequence:CCGGGCGAATCTGATGGCCTTAATTCTCGAGAATTAAGGCCATCAGATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010721.1-956s1c1
Sequence:CCGGGCGTCAGATTGAGTATGAGTACTCGAGTACTCATACTCAATCTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010721.1-769s1c1
Sequence:CCGGCCCAGCTAGAAGCATCCTTATCTCGAGATAAGGATGCTTCTAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010721.1-608s1c1
Sequence:CCGGGCTGCTCAATTATGCCAAGAACTCGAGTTCTTGGCATAATTGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010721.1-675s1c1
Sequence:CCGGGCGGCACTAAACTCTAAGGATCTCGAGATCCTTAGAGTTTAGTGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010721
VALIDATED
LMNB1 MISSION shRNA shRNA Plasmid DNA
lamin B1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010721.1-2140s1c1
Sequence:CCGGGCGAATCTGATGGCCTTAATTCTCGAGAATTAAGGCCATCAGATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010721.1-956s1c1
Sequence:CCGGGCGTCAGATTGAGTATGAGTACTCGAGTACTCATACTCAATCTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010721.1-769s1c1
Sequence:CCGGCCCAGCTAGAAGCATCCTTATCTCGAGATAAGGATGCTTCTAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010721.1-608s1c1
Sequence:CCGGGCTGCTCAATTATGCCAAGAACTCGAGTTCTTGGCATAATTGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010721.1-675s1c1
Sequence:CCGGGCGGCACTAAACTCTAAGGATCTCGAGATCCTTAGAGTTTAGTGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010721
VALIDATED
LMNB1 MISSION shRNA Lentiviral Transduction Particles
lamin B1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010721.1-2140s1c1
Sequence:CCGGGCGAATCTGATGGCCTTAATTCTCGAGAATTAAGGCCATCAGATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010721.1-956s1c1
Sequence:CCGGGCGTCAGATTGAGTATGAGTACTCGAGTACTCATACTCAATCTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010721.1-769s1c1
Sequence:CCGGCCCAGCTAGAAGCATCCTTATCTCGAGATAAGGATGCTTCTAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010721.1-608s1c1
Sequence:CCGGGCTGCTCAATTATGCCAAGAACTCGAGTTCTTGGCATAATTGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010721.1-675s1c1
Sequence:CCGGGCGGCACTAAACTCTAAGGATCTCGAGATCCTTAGAGTTTAGTGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)