EMAIL THIS PAGE TO A FRIEND

LMNB2

lamin B2

77 Gene Product Result for
Synonyms: LAMB2 LMN2
UniProtKB ID: Q03252, O75292, Q14734, Q96DF6
Gene ID:
Human(84823) Summary: This gene encodes a B type nuclear lamin. The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Mutations in this gene are associated with acquired partial lipodystrophy. [provided by RefSeq, May 2012]
Mouse(16907) lamin B2
Rat(299625) lamin B2
Zebrafish(30196) lamin B2
cow(516326) lamin B2
dog(485070) lamin B2
chicken(396222) lamin B2
sheep(101120243) lamin B2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306017 ANTI-LAMIN B2(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV46356 Anti-LMNB2 antibody produced in rabbit affinity isolated antibody bovine, human, guinea pig, mouse, horse
immunohistochemistry, western blot pricing
SAB2101353 Anti-LMNB2 antibody produced in rabbit affinity isolated antibody guinea pig, horse, dog, mouse, human, rat, bovine
western blot pricing
SAB2701053 Anti-LMNB2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB2701072 Anti-LMNB2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA047863 Anti-LMNB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
HPA062477 Anti-LMNB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2702205 Monoclonal Anti-Lamin B2 antibody produced in mouse clone GT144, affinity isolated antibody human
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010722 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010722 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010722 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032737 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032737 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032737 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028141 MISSION® esiRNA esiRNA human LMNB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032737 Rosetta Predictions human pricing
XM_001076027 Rosetta Predictions rat pricing
XM_216850 Rosetta Predictions rat pricing
NM_010722 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183110 predicted 1893
2 SASI_Hs01_00183112 predicted 1057
3 SASI_Hs01_00183113 predicted 2362
4 SASI_Hs01_00183114 predicted 1559
5 SASI_Hs01_00183115 predicted 592
6 SASI_Hs01_00183116 predicted 1770
7 SASI_Hs01_00183117 predicted 1870
8 SASI_Hs01_00183118 predicted 403
9 SASI_Hs01_00183119 predicted 2110
10 SASI_Hs02_00360283 predicted 1895
11 SASI_Hs01_00183111 predicted 2252
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351823 predicted 1520
2 SASI_Rn02_00351824 predicted 238
3 SASI_Rn02_00351825 predicted 1512
4 SASI_Rn02_00351826 predicted 1614
5 SASI_Rn02_00351827 predicted 336
6 SASI_Rn02_00351828 predicted 647
7 SASI_Rn02_00351829 predicted 446
8 SASI_Rn02_00351830 predicted 731
9 SASI_Rn02_00351831 predicted 833
10 SASI_Rn02_00351832 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216850 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376877 predicted 1522
2 SASI_Rn02_00376878 predicted 239
3 SASI_Rn02_00376879 predicted 1518
4 SASI_Rn02_00376880 predicted 1610
5 SASI_Rn02_00376881 predicted 339
6 SASI_Rn02_00376882 predicted 647
7 SASI_Rn02_00376883 predicted 440
8 SASI_Rn02_00376884 predicted 729
9 SASI_Rn02_00376885 predicted 833
10 SASI_Rn02_00376886 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010722 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319195 predicted 1550
2 SASI_Mm02_00319196 predicted 1637
3 SASI_Mm02_00319197 predicted 2156
4 SASI_Mm02_00319198 predicted 1064
5 SASI_Mm02_00319199 predicted 1046
6 SASI_Mm02_00319200 predicted 2146
7 SASI_Mm02_00319201 predicted 2151
8 SASI_Mm02_00319202 predicted 1170
9 SASI_Mm02_00319203 predicted 1547
10 SASI_Mm02_00319204 predicted 466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010722
VALIDATED
LMNB2 MISSION shRNA Bacterial Glycerol Stock
lamin B2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010722.5-1053s21c1
Sequence:CCGGGCGTGACAAGTTCCGCAAGATCTCGAGATCTTGCGGAACTTGTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010722.5-222s21c1
Sequence:CCGGGCTGGAGAATGATAGGTTGCTCTCGAGAGCAACCTATCATTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010722.5-2336s21c1
Sequence:CCGGGCTCTGAATCTGAAGGGTTTACTCGAGTAAACCCTTCAGATTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010722.5-1484s21c1
Sequence:CCGGCTTCAGACAAGGACCAGTCTTCTCGAGAAGACTGGTCCTTGTCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010722.3-681s1c1
Sequence:CCGGACAGGAATATGACTTCAAGATCTCGAGATCTTGAAGTCATATTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010722.3-2239s1c1
Sequence:CCGGGCTCTGAATCTGAAGGGTTTACTCGAGTAAACCCTTCAGATTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010722.3-1388s1c1
Sequence:CCGGCTTCAGACAAGGACCAGTCTTCTCGAGAAGACTGGTCCTTGTCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010722.3-138s1c1
Sequence:CCGGGCTGGAGAATGATAGGTTGCTCTCGAGAGCAACCTATCATTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010722.3-969s1c1
Sequence:CCGGGCGTGACAAGTTCCGCAAGATCTCGAGATCTTGCGGAACTTGTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010722
VALIDATED
LMNB2 MISSION shRNA shRNA Plasmid DNA
lamin B2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010722.5-1053s21c1
Sequence:CCGGGCGTGACAAGTTCCGCAAGATCTCGAGATCTTGCGGAACTTGTCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010722.5-222s21c1
Sequence:CCGGGCTGGAGAATGATAGGTTGCTCTCGAGAGCAACCTATCATTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010722.5-2336s21c1
Sequence:CCGGGCTCTGAATCTGAAGGGTTTACTCGAGTAAACCCTTCAGATTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010722.5-1484s21c1
Sequence:CCGGCTTCAGACAAGGACCAGTCTTCTCGAGAAGACTGGTCCTTGTCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010722.3-681s1c1
Sequence:CCGGACAGGAATATGACTTCAAGATCTCGAGATCTTGAAGTCATATTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010722.3-2239s1c1
Sequence:CCGGGCTCTGAATCTGAAGGGTTTACTCGAGTAAACCCTTCAGATTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010722.3-1388s1c1
Sequence:CCGGCTTCAGACAAGGACCAGTCTTCTCGAGAAGACTGGTCCTTGTCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010722.3-138s1c1
Sequence:CCGGGCTGGAGAATGATAGGTTGCTCTCGAGAGCAACCTATCATTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010722.3-969s1c1
Sequence:CCGGGCGTGACAAGTTCCGCAAGATCTCGAGATCTTGCGGAACTTGTCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010722
VALIDATED
LMNB2 MISSION shRNA Lentiviral Transduction Particles
lamin B2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010722.5-1053s21c1
Sequence:CCGGGCGTGACAAGTTCCGCAAGATCTCGAGATCTTGCGGAACTTGTCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010722.5-222s21c1
Sequence:CCGGGCTGGAGAATGATAGGTTGCTCTCGAGAGCAACCTATCATTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010722.5-2336s21c1
Sequence:CCGGGCTCTGAATCTGAAGGGTTTACTCGAGTAAACCCTTCAGATTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010722.5-1484s21c1
Sequence:CCGGCTTCAGACAAGGACCAGTCTTCTCGAGAAGACTGGTCCTTGTCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010722.3-681s1c1
Sequence:CCGGACAGGAATATGACTTCAAGATCTCGAGATCTTGAAGTCATATTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010722.3-2239s1c1
Sequence:CCGGGCTCTGAATCTGAAGGGTTTACTCGAGTAAACCCTTCAGATTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010722.3-1388s1c1
Sequence:CCGGCTTCAGACAAGGACCAGTCTTCTCGAGAAGACTGGTCCTTGTCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010722.3-138s1c1
Sequence:CCGGGCTGGAGAATGATAGGTTGCTCTCGAGAGCAACCTATCATTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010722.3-969s1c1
Sequence:CCGGGCGTGACAAGTTCCGCAAGATCTCGAGATCTTGCGGAACTTGTCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032737
VALIDATED
LMNB2 MISSION shRNA Bacterial Glycerol Stock
lamin B2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-1868s21c1
Sequence:CCGGCAAGAGGCTGCTACGTGATGTCTCGAGACATCACGTAGCAGCCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-2955s21c1
Sequence:CCGGTCGGCAATAGCTCACCGTTTACTCGAGTAAACGGTGAGCTATTGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-1772s21c1
Sequence:CCGGTGATGCGTGAGAATGAGAATGCTCGAGCATTCTCATTCTCACGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-900s21c1
Sequence:CCGGGAGCTCTGACCAGAACGACAACTCGAGTTGTCGTTCTGGTCAGAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-684s21c1
Sequence:CCGGGGACTTCCGGAAGAGTGTGTTCTCGAGAACACACTCTTCCGGAAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-1012s21c1
Sequence:CCGGAGTGCCGCTGAAGATCGCATTCTCGAGAATGCGATCTTCAGCGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032737.2-404s21c1
Sequence:CCGGCAGAGTTGGACGAGGTCAACACTCGAGTGTTGACCTCGTCCAACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255446    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-3960s21c1
Sequence:CCGGTGGGTAATTGGAGGTTCATTGCTCGAGCAATGAACCTCCAATTACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-1443s21c1
Sequence:CCGGTAGCGTCAGCATCGAGGAGATCTCGAGATCTCCTCGATGCTGACGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-1817s21c1
Sequence:CCGGAGTTTGGCGAGGAGGATCTTTCTCGAGAAAGATCCTCCTCGCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032737.2-1569s1c1
Sequence:CCGGCTACAAGTTCACGCCCAAGTACTCGAGTACTTGGGCGTGAACTTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032737.2-4361s1c1
Sequence:CCGGCGGCAGTTCTTTGTTAAAGATCTCGAGATCTTTAACAAAGAACTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032737.2-1488s1c1
Sequence:CCGGGCTCAAGAACAACTCGGACAACTCGAGTTGTCCGAGTTGTTCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032737.2-774s1c1
Sequence:CCGGGCAGGAGTACGACTTCAAGATCTCGAGATCTTGAAGTCGTACTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032737.2-771s1c1
Sequence:CCGGGCAGCAGGAGTACGACTTCAACTCGAGTTGAAGTCGTACTCCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032737
VALIDATED
LMNB2 MISSION shRNA shRNA Plasmid DNA
lamin B2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-1868s21c1
Sequence:CCGGCAAGAGGCTGCTACGTGATGTCTCGAGACATCACGTAGCAGCCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-2955s21c1
Sequence:CCGGTCGGCAATAGCTCACCGTTTACTCGAGTAAACGGTGAGCTATTGCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-1772s21c1
Sequence:CCGGTGATGCGTGAGAATGAGAATGCTCGAGCATTCTCATTCTCACGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-900s21c1
Sequence:CCGGGAGCTCTGACCAGAACGACAACTCGAGTTGTCGTTCTGGTCAGAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-684s21c1
Sequence:CCGGGGACTTCCGGAAGAGTGTGTTCTCGAGAACACACTCTTCCGGAAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-1012s21c1
Sequence:CCGGAGTGCCGCTGAAGATCGCATTCTCGAGAATGCGATCTTCAGCGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032737.2-404s21c1
Sequence:CCGGCAGAGTTGGACGAGGTCAACACTCGAGTGTTGACCTCGTCCAACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255446    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-3960s21c1
Sequence:CCGGTGGGTAATTGGAGGTTCATTGCTCGAGCAATGAACCTCCAATTACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-1443s21c1
Sequence:CCGGTAGCGTCAGCATCGAGGAGATCTCGAGATCTCCTCGATGCTGACGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-1817s21c1
Sequence:CCGGAGTTTGGCGAGGAGGATCTTTCTCGAGAAAGATCCTCCTCGCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032737.2-1569s1c1
Sequence:CCGGCTACAAGTTCACGCCCAAGTACTCGAGTACTTGGGCGTGAACTTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032737.2-4361s1c1
Sequence:CCGGCGGCAGTTCTTTGTTAAAGATCTCGAGATCTTTAACAAAGAACTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032737.2-1488s1c1
Sequence:CCGGGCTCAAGAACAACTCGGACAACTCGAGTTGTCCGAGTTGTTCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032737.2-774s1c1
Sequence:CCGGGCAGGAGTACGACTTCAAGATCTCGAGATCTTGAAGTCGTACTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032737.2-771s1c1
Sequence:CCGGGCAGCAGGAGTACGACTTCAACTCGAGTTGAAGTCGTACTCCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032737
VALIDATED
LMNB2 MISSION shRNA Lentiviral Transduction Particles
lamin B2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-1868s21c1
Sequence:CCGGCAAGAGGCTGCTACGTGATGTCTCGAGACATCACGTAGCAGCCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-2955s21c1
Sequence:CCGGTCGGCAATAGCTCACCGTTTACTCGAGTAAACGGTGAGCTATTGCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-1772s21c1
Sequence:CCGGTGATGCGTGAGAATGAGAATGCTCGAGCATTCTCATTCTCACGCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-900s21c1
Sequence:CCGGGAGCTCTGACCAGAACGACAACTCGAGTTGTCGTTCTGGTCAGAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-684s21c1
Sequence:CCGGGGACTTCCGGAAGAGTGTGTTCTCGAGAACACACTCTTCCGGAAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-1012s21c1
Sequence:CCGGAGTGCCGCTGAAGATCGCATTCTCGAGAATGCGATCTTCAGCGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032737.2-404s21c1
Sequence:CCGGCAGAGTTGGACGAGGTCAACACTCGAGTGTTGACCTCGTCCAACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255446    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-3960s21c1
Sequence:CCGGTGGGTAATTGGAGGTTCATTGCTCGAGCAATGAACCTCCAATTACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-1443s21c1
Sequence:CCGGTAGCGTCAGCATCGAGGAGATCTCGAGATCTCCTCGATGCTGACGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032737.2-1817s21c1
Sequence:CCGGAGTTTGGCGAGGAGGATCTTTCTCGAGAAAGATCCTCCTCGCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032737.2-1569s1c1
Sequence:CCGGCTACAAGTTCACGCCCAAGTACTCGAGTACTTGGGCGTGAACTTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032737.2-4361s1c1
Sequence:CCGGCGGCAGTTCTTTGTTAAAGATCTCGAGATCTTTAACAAAGAACTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032737.2-1488s1c1
Sequence:CCGGGCTCAAGAACAACTCGGACAACTCGAGTTGTCCGAGTTGTTCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032737.2-774s1c1
Sequence:CCGGGCAGGAGTACGACTTCAAGATCTCGAGATCTTGAAGTCGTACTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032737.2-771s1c1
Sequence:CCGGGCAGCAGGAGTACGACTTCAACTCGAGTTGAAGTCGTACTCCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)