EMAIL THIS PAGE TO A FRIEND

LMO1

LIM domain only 1 (rhombotin 1)

79 Gene Product Result for
Synonyms: RBTN1 RHOM1 TTG1
UniProtKB ID: P25800, E9PSF5, Q4VBC5, Q8IXR0
Gene ID:
Human(4004) Summary: This locus encodes a transcriptional regulator that contains two cysteine-rich LIM domains but lacks a DNA-binding domain. LIM domains may play a role in protein interactions; thus the encoded protein may regulate transcription by competitively binding to specific DNA-binding transcription factors. Alterations at this locus have been associated with acute lymphoblastic T-cell leukemia. Chromosomal rearrangements have been observed between this locus and at least two loci, the delta subunit of the T-cell antigen receptor gene and the LIM domain binding 1 gene. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2012]
Mouse(109594) LIM domain only 1
Rat(245979) LIM domain only 1
Zebrafish(280646) LIM domain only 1
domestic cat(101090387) LIM domain only 1 (rhombotin 1)
cow(527152) LIM domain only 1 (rhombotin 1)
dog(610473) LIM domain only 1 (rhombotin 1)
sheep(101102757) LIM domain only 1 (rhombotin 1)
domestic guinea pig(100714625) LIM domain only 1 (rhombotin 1)
naked mole-rat(101723008) LIM domain only 1 (rhombotin 1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_057173 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_057173 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_057173 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002315 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122881 MISSION® esiRNA esiRNA human LMO1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002315 Rosetta Predictions human pricing
NM_139112 Rosetta Predictions rat pricing
XM_579663 Rosetta Predictions rat pricing
NM_057173 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164454 predicted 593
2 SASI_Hs01_00164455 predicted 717
3 SASI_Hs01_00164456 predicted 572
4 SASI_Hs01_00164457 predicted 567
5 SASI_Hs01_00164458 predicted 629
6 SASI_Hs01_00164459 predicted 749
7 SASI_Hs01_00164460 predicted 632
8 SASI_Hs01_00164461 predicted 613
9 SASI_Hs01_00164462 predicted 587
10 SASI_Hs01_00164463 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139112 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268492 predicted 557
2 SASI_Rn01_00092047 predicted 309
3 SASI_Rn01_00092048 predicted 402
4 SASI_Rn02_00268493 predicted 555
5 SASI_Rn01_00092049 predicted 435
6 SASI_Rn01_00092050 predicted 462
7 SASI_Rn02_00268494 predicted 236
8 SASI_Rn02_00268495 predicted 574
9 SASI_Rn01_00092053 predicted 395
10 SASI_Rn01_00092054 predicted 432
11 SASI_Rn01_00092051 predicted 496
12 SASI_Rn01_00092052 predicted 228
13 SASI_Rn01_00092055 predicted 404
14 SASI_Rn01_00092056 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579663 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00158084 predicted 306
2 SASI_Rn01_00158085 predicted 313
3 SASI_Rn01_00158086 predicted 299
4 SASI_Rn01_00158087 predicted 303
5 SASI_Rn01_00158088 predicted 295
6 SASI_Rn01_00158089 predicted 285
7 SASI_Rn01_00158090 predicted 322
8 SASI_Rn01_00158091 predicted 308
9 SASI_Rn01_00158092 predicted 305
10 SASI_Rn01_00158093 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057173 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042078 predicted 503
2 SASI_Mm02_00338060 predicted 673
3 SASI_Mm01_00042079 predicted 748
4 SASI_Mm01_00042080 predicted 593
5 SASI_Mm01_00042081 predicted 574
6 SASI_Mm01_00042082 predicted 706
7 SASI_Mm02_00338061 predicted 333
8 SASI_Mm01_00042083 predicted 444
9 SASI_Mm01_00042084 predicted 610
10 SASI_Mm02_00338062 predicted 611
11 SASI_Mm01_00042075 predicted 941
12 SASI_Mm01_00042076 predicted 942
13 SASI_Mm01_00042077 predicted 951
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_057173
LMO1 MISSION shRNA Bacterial Glycerol Stock
LIM domain only 1 (rhombotin 1)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057173.2-669s21c1
Sequence:CCGGTTTGCGTGGGAGACAAATTCTCTCGAGAGAATTTGTCTCCCACGCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057173.2-868s21c1
Sequence:CCGGAGCCGCTGTCCTACAAGTTAGCTCGAGCTAACTTGTAGGACAGCGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057173.2-335s21c1
Sequence:CCGGATGCTCTCCGTCCAACCTAAGCTCGAGCTTAGGTTGGACGGAGAGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057173.2-764s21c1
Sequence:CCGGGTTCAGTAACGCCCACCATCTCTCGAGAGATGGTGGGCGTTACTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057173.2-968s21c1
Sequence:CCGGAGCCTGTACAGTCTGTCTTCTCTCGAGAGAAGACAGACTGTACAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057173.1-729s1c1
Sequence:CCGGCGGCGTGACTACCTGAGGCTTCTCGAGAAGCCTCAGGTAGTCACGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057173.1-818s1c1
Sequence:CCGGCCGAGACAATGTGTATCACCTCTCGAGAGGTGATACACATTGTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057173.1-896s1c1
Sequence:CCGGCCTGAAGAACAACATGATCTTCTCGAGAAGATCATGTTGTTCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057173.1-578s1c1
Sequence:CCGGCGCAGGCTGCAACCGCAAGATCTCGAGATCTTGCGGTTGCAGCCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057173.1-942s1c1
Sequence:CCGGCATCTCAATGGCACCTTTGAACTCGAGTTCAAAGGTGCCATTGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_057173
LMO1 MISSION shRNA shRNA Plasmid DNA
LIM domain only 1 (rhombotin 1)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057173.2-669s21c1
Sequence:CCGGTTTGCGTGGGAGACAAATTCTCTCGAGAGAATTTGTCTCCCACGCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057173.2-868s21c1
Sequence:CCGGAGCCGCTGTCCTACAAGTTAGCTCGAGCTAACTTGTAGGACAGCGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057173.2-335s21c1
Sequence:CCGGATGCTCTCCGTCCAACCTAAGCTCGAGCTTAGGTTGGACGGAGAGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057173.2-764s21c1
Sequence:CCGGGTTCAGTAACGCCCACCATCTCTCGAGAGATGGTGGGCGTTACTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057173.2-968s21c1
Sequence:CCGGAGCCTGTACAGTCTGTCTTCTCTCGAGAGAAGACAGACTGTACAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057173.1-729s1c1
Sequence:CCGGCGGCGTGACTACCTGAGGCTTCTCGAGAAGCCTCAGGTAGTCACGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057173.1-818s1c1
Sequence:CCGGCCGAGACAATGTGTATCACCTCTCGAGAGGTGATACACATTGTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057173.1-896s1c1
Sequence:CCGGCCTGAAGAACAACATGATCTTCTCGAGAAGATCATGTTGTTCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057173.1-578s1c1
Sequence:CCGGCGCAGGCTGCAACCGCAAGATCTCGAGATCTTGCGGTTGCAGCCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057173.1-942s1c1
Sequence:CCGGCATCTCAATGGCACCTTTGAACTCGAGTTCAAAGGTGCCATTGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_057173
LMO1 MISSION shRNA Lentiviral Transduction Particles
LIM domain only 1 (rhombotin 1)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057173.2-669s21c1
Sequence:CCGGTTTGCGTGGGAGACAAATTCTCTCGAGAGAATTTGTCTCCCACGCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057173.2-868s21c1
Sequence:CCGGAGCCGCTGTCCTACAAGTTAGCTCGAGCTAACTTGTAGGACAGCGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057173.2-335s21c1
Sequence:CCGGATGCTCTCCGTCCAACCTAAGCTCGAGCTTAGGTTGGACGGAGAGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057173.2-764s21c1
Sequence:CCGGGTTCAGTAACGCCCACCATCTCTCGAGAGATGGTGGGCGTTACTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057173.2-968s21c1
Sequence:CCGGAGCCTGTACAGTCTGTCTTCTCTCGAGAGAAGACAGACTGTACAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057173.1-729s1c1
Sequence:CCGGCGGCGTGACTACCTGAGGCTTCTCGAGAAGCCTCAGGTAGTCACGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057173.1-818s1c1
Sequence:CCGGCCGAGACAATGTGTATCACCTCTCGAGAGGTGATACACATTGTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057173.1-896s1c1
Sequence:CCGGCCTGAAGAACAACATGATCTTCTCGAGAAGATCATGTTGTTCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057173.1-578s1c1
Sequence:CCGGCGCAGGCTGCAACCGCAAGATCTCGAGATCTTGCGGTTGCAGCCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057173.1-942s1c1
Sequence:CCGGCATCTCAATGGCACCTTTGAACTCGAGTTCAAAGGTGCCATTGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002315
VALIDATED
LMO1 MISSION shRNA Bacterial Glycerol Stock
LIM domain only 1 (rhombotin 1)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002315.1-605s21c1
Sequence:CCGGGCTGAAGGCATTGGACAAGTACTCGAGTACTTGTCCAATGCCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002315.1-1067s21c1
Sequence:CCGGCGCTCTCCTGCCACATTAGAACTCGAGTTCTAATGTGGCAGGAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002315.1-944s21c1
Sequence:CCGGCACCTTTGAATCCCAAGTTCACTCGAGTGAACTTGGGATTCAAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002315.1-922s21c1
Sequence:CCGGATGAGGAAGGGCAGCTCAATGCTCGAGCATTGAGCTGCCCTTCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002315.1-896s21c1
Sequence:CCGGCAACATGATCTTGTGTCAGATCTCGAGATCTGACACAAGATCATGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002315.1-896s1c1
Sequence:CCGGCAACATGATCTTGTGTCAGATCTCGAGATCTGACACAAGATCATGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_002315.1-723s1c1
Sequence:CCGGCGCGACTACCTGAGGCTCTTTCTCGAGAAAGAGCCTCAGGTAGTCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002315.1-846s1c1
Sequence:CCGGCAGCTCTGCAACCAGAGATTTCTCGAGAAATCTCTGGTTGCAGAGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_002315.1-1076s1c1
Sequence:CCGGGCCACATTAGAACTTCTCCGTCTCGAGACGGAGAAGTTCTAATGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_002315.1-933s1c1
Sequence:CCGGCAGCTCAATGGCACCTTTGAACTCGAGTTCAAAGGTGCCATTGAGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002315
VALIDATED
LMO1 MISSION shRNA shRNA Plasmid DNA
LIM domain only 1 (rhombotin 1)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002315.1-605s21c1
Sequence:CCGGGCTGAAGGCATTGGACAAGTACTCGAGTACTTGTCCAATGCCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002315.1-1067s21c1
Sequence:CCGGCGCTCTCCTGCCACATTAGAACTCGAGTTCTAATGTGGCAGGAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002315.1-944s21c1
Sequence:CCGGCACCTTTGAATCCCAAGTTCACTCGAGTGAACTTGGGATTCAAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002315.1-922s21c1
Sequence:CCGGATGAGGAAGGGCAGCTCAATGCTCGAGCATTGAGCTGCCCTTCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002315.1-896s21c1
Sequence:CCGGCAACATGATCTTGTGTCAGATCTCGAGATCTGACACAAGATCATGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002315.1-896s1c1
Sequence:CCGGCAACATGATCTTGTGTCAGATCTCGAGATCTGACACAAGATCATGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_002315.1-723s1c1
Sequence:CCGGCGCGACTACCTGAGGCTCTTTCTCGAGAAAGAGCCTCAGGTAGTCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002315.1-846s1c1
Sequence:CCGGCAGCTCTGCAACCAGAGATTTCTCGAGAAATCTCTGGTTGCAGAGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_002315.1-1076s1c1
Sequence:CCGGGCCACATTAGAACTTCTCCGTCTCGAGACGGAGAAGTTCTAATGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_002315.1-933s1c1
Sequence:CCGGCAGCTCAATGGCACCTTTGAACTCGAGTTCAAAGGTGCCATTGAGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002315
VALIDATED
LMO1 MISSION shRNA Lentiviral Transduction Particles
LIM domain only 1 (rhombotin 1)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002315.1-605s21c1
Sequence:CCGGGCTGAAGGCATTGGACAAGTACTCGAGTACTTGTCCAATGCCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002315.1-1067s21c1
Sequence:CCGGCGCTCTCCTGCCACATTAGAACTCGAGTTCTAATGTGGCAGGAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002315.1-944s21c1
Sequence:CCGGCACCTTTGAATCCCAAGTTCACTCGAGTGAACTTGGGATTCAAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002315.1-922s21c1
Sequence:CCGGATGAGGAAGGGCAGCTCAATGCTCGAGCATTGAGCTGCCCTTCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002315.1-896s21c1
Sequence:CCGGCAACATGATCTTGTGTCAGATCTCGAGATCTGACACAAGATCATGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002315.1-896s1c1
Sequence:CCGGCAACATGATCTTGTGTCAGATCTCGAGATCTGACACAAGATCATGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_002315.1-723s1c1
Sequence:CCGGCGCGACTACCTGAGGCTCTTTCTCGAGAAAGAGCCTCAGGTAGTCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002315.1-846s1c1
Sequence:CCGGCAGCTCTGCAACCAGAGATTTCTCGAGAAATCTCTGGTTGCAGAGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_002315.1-1076s1c1
Sequence:CCGGGCCACATTAGAACTTCTCCGTCTCGAGACGGAGAAGTTCTAATGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_002315.1-933s1c1
Sequence:CCGGCAGCTCAATGGCACCTTTGAACTCGAGTTCAAAGGTGCCATTGAGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)