EMAIL THIS PAGE TO A FRIEND

LMO2

LIM domain only 2 (rhombotin-like 1)

104 Gene Product Result for
Synonyms: RBTN2 RBTNL1 RHOM2 TTG2
UniProtKB ID: P25791, Q9HD58
Gene ID:
Human(4005) Summary: LMO2 encodes a cysteine-rich, two LIM-domain protein that is required for yolk sac erythropoiesis. The LMO2 protein has a central and crucial role in hematopoietic development and is highly conserved. The LMO2 transcription start site is located approximately 25 kb downstream from the 11p13 T-cell translocation cluster (11p13 ttc), where a number T-cell acute lymphoblastic leukemia-specific translocations occur. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Nov 2008]
Mouse(16909) LIM domain only 2
Rat(362176) LIM domain only 2
sheep(101103346) LIM domain only 2 (rhombotin-like 1)
Zebrafish(30332) LIM domain only 2 (rhombotin-like 1)
cow(614876) LIM domain only 2 (rhombotin-like 1)
domestic cat(101092888) LIM domain only 2 (rhombotin-like 1)
dog(609006) LIM domain only 2 (rhombotin-like 1)
chicken(374129) LIM domain only 2 (rhombotin-like 1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1105809 Anti-LMO2 (71-80) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1412285 ANTI-LMO2 antibody produced in mouse clone 4C6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412286 ANTI-LMO2 antibody produced in mouse clone 4D3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412287 ANTI-LMO2 antibody produced in mouse clone 4E2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1410760 Anti-LMO2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA029285 Anti-LMO2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB5500137 Anti-LMO2 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP51, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
SAB2104012 Anti-LMO2, (N-terminal) antibody produced in rabbit affinity isolated antibody rat, rabbit, bovine, guinea pig, human, mouse
western blot pricing
WH0004005M1 Monoclonal Anti-LMO2 antibody produced in mouse clone 6B8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404029 Monoclonal Anti-LMO2 antibody produced in mouse clone 2B3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005574 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005574 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005574 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008505 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008505 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008505 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005574 Rosetta Predictions human pricing
NM_001037358 Rosetta Predictions rat pricing
NM_008505 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074773 predicted 1879
2 SASI_Hs01_00074774 predicted 1485
3 SASI_Hs01_00074775 predicted 1746
4 SASI_Hs01_00074776 predicted 1828
5 SASI_Hs01_00074777 predicted 1877
6 SASI_Hs01_00074778 predicted 2008
7 SASI_Hs01_00074779 predicted 1809
8 SASI_Hs01_00074780 predicted 1639
9 SASI_Hs01_00074781 predicted 1374
10 SASI_Hs02_00339854 predicted 1470
11 SASI_Hs01_00074782 predicted 1157
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036713 predicted 852
2 SASI_Rn01_00036714 predicted 541
3 SASI_Rn01_00036715 predicted 525
4 SASI_Rn01_00036716 predicted 929
5 SASI_Rn01_00036717 predicted 727
6 SASI_Rn01_00036718 predicted 1011
7 SASI_Rn01_00036719 predicted 744
8 SASI_Rn02_00204409 predicted 798
9 SASI_Rn02_00204410 predicted 994
10 SASI_Rn01_00036721 predicted 1076
11 SASI_Rn01_00036720 predicted 1027
12 SASI_Rn01_00036722 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008505 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112910 predicted 1115
2 SASI_Mm01_00112911 predicted 899
3 SASI_Mm01_00112912 predicted 765
4 SASI_Mm01_00112913 predicted 1072
5 SASI_Mm01_00112914 predicted 1038
6 SASI_Mm01_00112915 predicted 1050
7 SASI_Mm01_00112916 predicted 813
8 SASI_Mm01_00112917 predicted 682
9 SASI_Mm01_00112918 predicted 1136
10 SASI_Mm01_00112919 predicted 861
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005574
LMO2 MISSION shRNA Bacterial Glycerol Stock
LIM domain only 2 (rhombotin-like 1)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005574.2-1751s1c1
Sequence:CCGGCCATAGTAACTGACATGATTACTCGAGTAATCATGTCAGTTACTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005574.2-1360s1c1
Sequence:CCGGGCGGGTGAAAGACAAAGTGTACTCGAGTACACTTTGTCTTTCACCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005574.2-1429s1c1
Sequence:CCGGAGGTGACAGATACCTCCTCATCTCGAGATGAGGAGGTATCTGTCACCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005574.2-1319s1c1
Sequence:CCGGGCATCCTGTGACAAGCGGATTCTCGAGAATCCGCTTGTCACAGGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005574.2-1491s1c1
Sequence:CCGGCTAAGATCAATGGGATGATATCTCGAGATATCATCCCATTGATCTTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005574.3-1664s21c1
Sequence:CCGGTAGCATCCAAGTGGCATAATTCTCGAGAATTATGCCACTTGGATGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005574.3-1455s21c1
Sequence:CCGGTCTGACATAGTGTGCGAACAGCTCGAGCTGTTCGCACACTATGTCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005574
LMO2 MISSION shRNA shRNA Plasmid DNA
LIM domain only 2 (rhombotin-like 1)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005574.2-1751s1c1
Sequence:CCGGCCATAGTAACTGACATGATTACTCGAGTAATCATGTCAGTTACTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005574.2-1360s1c1
Sequence:CCGGGCGGGTGAAAGACAAAGTGTACTCGAGTACACTTTGTCTTTCACCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005574.2-1429s1c1
Sequence:CCGGAGGTGACAGATACCTCCTCATCTCGAGATGAGGAGGTATCTGTCACCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005574.2-1319s1c1
Sequence:CCGGGCATCCTGTGACAAGCGGATTCTCGAGAATCCGCTTGTCACAGGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005574.2-1491s1c1
Sequence:CCGGCTAAGATCAATGGGATGATATCTCGAGATATCATCCCATTGATCTTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005574.3-1664s21c1
Sequence:CCGGTAGCATCCAAGTGGCATAATTCTCGAGAATTATGCCACTTGGATGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005574.3-1455s21c1
Sequence:CCGGTCTGACATAGTGTGCGAACAGCTCGAGCTGTTCGCACACTATGTCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005574
LMO2 MISSION shRNA Lentiviral Transduction Particles
LIM domain only 2 (rhombotin-like 1)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005574.2-1751s1c1
Sequence:CCGGCCATAGTAACTGACATGATTACTCGAGTAATCATGTCAGTTACTATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005574.2-1360s1c1
Sequence:CCGGGCGGGTGAAAGACAAAGTGTACTCGAGTACACTTTGTCTTTCACCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005574.2-1429s1c1
Sequence:CCGGAGGTGACAGATACCTCCTCATCTCGAGATGAGGAGGTATCTGTCACCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005574.2-1319s1c1
Sequence:CCGGGCATCCTGTGACAAGCGGATTCTCGAGAATCCGCTTGTCACAGGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005574.2-1491s1c1
Sequence:CCGGCTAAGATCAATGGGATGATATCTCGAGATATCATCCCATTGATCTTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005574.3-1664s21c1
Sequence:CCGGTAGCATCCAAGTGGCATAATTCTCGAGAATTATGCCACTTGGATGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005574.3-1455s21c1
Sequence:CCGGTCTGACATAGTGTGCGAACAGCTCGAGCTGTTCGCACACTATGTCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008505
LMO2 MISSION shRNA Bacterial Glycerol Stock
LIM domain only 2 (rhombotin-like 1)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008505.3-1155s1c1
Sequence:CCGGCCATAGTAACTGACAAGATTACTCGAGTAATCTTGTCAGTTACTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008505.3-902s1c1
Sequence:CCGGGACCAAGATCAATGGGATCATCTCGAGATGATCCCATTGATCTTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008505.3-774s1c1
Sequence:CCGGCGGGTGAAAGACAAAGTGTATCTCGAGATACACTTTGTCTTTCACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008505.3-872s1c1
Sequence:CCGGCATAGTGTGTGAACAAGACATCTCGAGATGTCTTGTTCACACACTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008505.3-867s1c1
Sequence:CCGGTCCGACATAGTGTGTGAACAACTCGAGTTGTTCACACACTATGTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008505.4-958s21c1
Sequence:CCGGGAGGCATTTCTTAGGAGATTACTCGAGTAATCTCCTAAGAAATGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008505.4-1201s21c1
Sequence:CCGGATGGACTAGAGTTGTGCAATTCTCGAGAATTGCACAACTCTAGTCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008505
LMO2 MISSION shRNA shRNA Plasmid DNA
LIM domain only 2 (rhombotin-like 1)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008505.3-1155s1c1
Sequence:CCGGCCATAGTAACTGACAAGATTACTCGAGTAATCTTGTCAGTTACTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008505.3-902s1c1
Sequence:CCGGGACCAAGATCAATGGGATCATCTCGAGATGATCCCATTGATCTTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008505.3-774s1c1
Sequence:CCGGCGGGTGAAAGACAAAGTGTATCTCGAGATACACTTTGTCTTTCACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008505.3-872s1c1
Sequence:CCGGCATAGTGTGTGAACAAGACATCTCGAGATGTCTTGTTCACACACTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008505.3-867s1c1
Sequence:CCGGTCCGACATAGTGTGTGAACAACTCGAGTTGTTCACACACTATGTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008505.4-958s21c1
Sequence:CCGGGAGGCATTTCTTAGGAGATTACTCGAGTAATCTCCTAAGAAATGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008505.4-1201s21c1
Sequence:CCGGATGGACTAGAGTTGTGCAATTCTCGAGAATTGCACAACTCTAGTCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008505
LMO2 MISSION shRNA Lentiviral Transduction Particles
LIM domain only 2 (rhombotin-like 1)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008505.3-1155s1c1
Sequence:CCGGCCATAGTAACTGACAAGATTACTCGAGTAATCTTGTCAGTTACTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008505.3-902s1c1
Sequence:CCGGGACCAAGATCAATGGGATCATCTCGAGATGATCCCATTGATCTTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008505.3-774s1c1
Sequence:CCGGCGGGTGAAAGACAAAGTGTATCTCGAGATACACTTTGTCTTTCACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008505.3-872s1c1
Sequence:CCGGCATAGTGTGTGAACAAGACATCTCGAGATGTCTTGTTCACACACTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008505.3-867s1c1
Sequence:CCGGTCCGACATAGTGTGTGAACAACTCGAGTTGTTCACACACTATGTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008505.4-958s21c1
Sequence:CCGGGAGGCATTTCTTAGGAGATTACTCGAGTAATCTCCTAAGAAATGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008505.4-1201s21c1
Sequence:CCGGATGGACTAGAGTTGTGCAATTCTCGAGAATTGCACAACTCTAGTCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)