EMAIL THIS PAGE TO A FRIEND

LMO3

LIM domain only 3 (rhombotin-like 2)

206 Gene Product Result for
Synonyms: RBTN3 RBTNL2 RHOM3 Rhom-3
Gene ID:
Human(55885) Summary: The protein encoded by this gene belongs to the rhombotin family of cysteine-rich LIM domain oncogenes. This gene is predominantly expressed in the brain. Related family members, LMO1 and LMO2 on chromosome 11, have been reported to be involved in chromosomal translocations in T-cell leukemia. Many alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(109593) LIM domain only 3
Zebrafish(553774) LIM domain only 3
chicken(418179) LIM domain only 3 (rhombotin-like 2)
cow(532870) LIM domain only 3 (rhombotin-like 2)
domestic cat(101099813) LIM domain only 3 (rhombotin-like 2)
dog(486662) LIM domain only 3 (rhombotin-like 2)
sheep(101123620) LIM domain only 3 (rhombotin-like 2)
domestic guinea pig(100712831) LIM domain only 3 (rhombotin-like 2)
naked mole-rat(101711514) LIM domain only 3 (rhombotin-like 2)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412113 ANTI-LMO3 antibody produced in mouse clone 4B9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412114 ANTI-LMO3 antibody produced in mouse clone 4A8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412115 ANTI-LMO3 antibody produced in mouse clone 4C4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412116 ANTI-LMO3 antibody produced in mouse clone 3G7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412172 ANTI-LMO3 antibody produced in mouse clone 2D6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412609 ANTI-LMO3 antibody produced in mouse clone 3H8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2106428 Anti-LMO3 antibody produced in rabbit affinity isolated antibody human, mouse, horse, guinea pig, rabbit
western blot pricing
SAB4502376 Anti-LMO3, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
WH0055885M3 Monoclonal Anti-LMO3 antibody produced in mouse clone 2H2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1405170 Monoclonal Anti-LMO3, (C-terminal) antibody produced in mouse clone 1A8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018640 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018640 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018640 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207222 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207222 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207222 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070251 MISSION® esiRNA esiRNA human LMO3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001395 Rosetta Predictions human pricing
NM_018640 Rosetta Predictions human pricing
NM_207222 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100451 predicted 361
2 SASI_Hs01_00100452 predicted 771
3 SASI_Hs01_00100453 predicted 366
4 SASI_Hs01_00100454 predicted 687
5 SASI_Hs01_00100455 predicted 462
6 SASI_Hs01_00100456 predicted 619
7 SASI_Hs01_00100457 predicted 776
8 SASI_Hs01_00100459 predicted 1078
9 SASI_Hs02_00303732 predicted 961
10 SASI_Hs02_00303733 predicted 1047
11 SASI_Hs01_00100458 predicted 470
12 SASI_Hs01_00100460 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213788 predicted 642
2 SASI_Hs01_00213789 predicted 1041
3 SASI_Hs01_00213790 predicted 641
4 SASI_Hs01_00213791 predicted 958
5 SASI_Hs01_00213792 predicted 738
6 SASI_Hs01_00213793 predicted 894
7 SASI_Hs01_00213794 predicted 1050
8 SASI_Hs01_00213796 predicted 1355
9 SASI_Hs02_00352138 predicted 1236
10 SASI_Hs02_00352139 predicted 1326
11 SASI_Hs01_00213795 predicted 750
12 SASI_Hs01_00213797 predicted 1234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207222 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199617 predicted 351
2 SASI_Mm01_00199618 predicted 404
3 SASI_Mm01_00199619 predicted 1092
4 SASI_Mm02_00351942 predicted 1049
5 SASI_Mm01_00199620 predicted 1029
6 SASI_Mm01_00199621 predicted 1098
7 SASI_Mm01_00199622 predicted 921
8 SASI_Mm01_00199624 predicted 812
9 SASI_Mm01_00199625 predicted 1112
10 SASI_Mm01_00199626 predicted 916
11 SASI_Mm01_00199623 predicted 996
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018640
LMO3 MISSION shRNA Bacterial Glycerol Stock
LIM domain only 3 (rhombotin-like 2)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018640.3-602s21c1
Sequence:CCGGGTACACTAAAGCTAATCTTATCTCGAGATAAGATTAGCTTTAGTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018640.3-500s21c1
Sequence:CCGGCAAGGACCGGTATCTTCTAAACTCGAGTTTAGAAGATACCGGTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018640.3-1024s21c1
Sequence:CCGGTGCATCTGTATGTAGTGAAATCTCGAGATTTCACTACATACAGATGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018640.3-525s1c1
Sequence:CCGGCTGGACAAATACTGGCATGAACTCGAGTTCATGCCAGTATTTGTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018640.3-713s1c1
Sequence:CCGGGCGTGCCAAGGACAATGTTTACTCGAGTAAACATTGTCCTTGGCACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018640.3-825s1c1
Sequence:CCGGACGGACTACGAGGAAGGTTTACTCGAGTAAACCTTCCTCGTAGTCCGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018640.3-754s1c1
Sequence:CCGGGTCAGCTTTGTAATCAGAGATCTCGAGATCTCTGATTACAAAGCTGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018640.3-647s1c1
Sequence:CCGGGCTCTTTGGTGTAACGGGAAACTCGAGTTTCCCGTTACACCAAAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018640
LMO3 MISSION shRNA shRNA Plasmid DNA
LIM domain only 3 (rhombotin-like 2)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018640.3-602s21c1
Sequence:CCGGGTACACTAAAGCTAATCTTATCTCGAGATAAGATTAGCTTTAGTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018640.3-500s21c1
Sequence:CCGGCAAGGACCGGTATCTTCTAAACTCGAGTTTAGAAGATACCGGTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018640.3-1024s21c1
Sequence:CCGGTGCATCTGTATGTAGTGAAATCTCGAGATTTCACTACATACAGATGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018640.3-525s1c1
Sequence:CCGGCTGGACAAATACTGGCATGAACTCGAGTTCATGCCAGTATTTGTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018640.3-713s1c1
Sequence:CCGGGCGTGCCAAGGACAATGTTTACTCGAGTAAACATTGTCCTTGGCACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018640.3-825s1c1
Sequence:CCGGACGGACTACGAGGAAGGTTTACTCGAGTAAACCTTCCTCGTAGTCCGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018640.3-754s1c1
Sequence:CCGGGTCAGCTTTGTAATCAGAGATCTCGAGATCTCTGATTACAAAGCTGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018640.3-647s1c1
Sequence:CCGGGCTCTTTGGTGTAACGGGAAACTCGAGTTTCCCGTTACACCAAAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018640
LMO3 MISSION shRNA Lentiviral Transduction Particles
LIM domain only 3 (rhombotin-like 2)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018640.3-602s21c1
Sequence:CCGGGTACACTAAAGCTAATCTTATCTCGAGATAAGATTAGCTTTAGTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018640.3-500s21c1
Sequence:CCGGCAAGGACCGGTATCTTCTAAACTCGAGTTTAGAAGATACCGGTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018640.3-1024s21c1
Sequence:CCGGTGCATCTGTATGTAGTGAAATCTCGAGATTTCACTACATACAGATGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018640.3-525s1c1
Sequence:CCGGCTGGACAAATACTGGCATGAACTCGAGTTCATGCCAGTATTTGTCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018640.3-713s1c1
Sequence:CCGGGCGTGCCAAGGACAATGTTTACTCGAGTAAACATTGTCCTTGGCACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018640.3-825s1c1
Sequence:CCGGACGGACTACGAGGAAGGTTTACTCGAGTAAACCTTCCTCGTAGTCCGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018640.3-754s1c1
Sequence:CCGGGTCAGCTTTGTAATCAGAGATCTCGAGATCTCTGATTACAAAGCTGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018640.3-647s1c1
Sequence:CCGGGCTCTTTGGTGTAACGGGAAACTCGAGTTTCCCGTTACACCAAAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207222
LMO3 MISSION shRNA Bacterial Glycerol Stock
LIM domain only 3 (rhombotin-like 2)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207222.1-434s1c1
Sequence:CCGGCGCTGCCTGTAGCAAGCTCATCTCGAGATGAGCTTGCTACAGGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207222.1-1823s1c1
Sequence:CCGGCCTGCCATTTACTTTAATCTTCTCGAGAAGATTAAAGTAAATGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207222.1-602s1c1
Sequence:CCGGAGGCCTCATGAAAGAAGGCTACTCGAGTAGCCTTCTTTCATGAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207222.1-395s1c1
Sequence:CCGGCAGAGACTATCTGAGGCTGTTCTCGAGAACAGCCTCAGATAGTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207222.1-370s1c1
Sequence:CCGGCGAAGGCTAACCTTATCCTTTCTCGAGAAAGGATAAGGTTAGCCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207222
LMO3 MISSION shRNA shRNA Plasmid DNA
LIM domain only 3 (rhombotin-like 2)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207222.1-434s1c1
Sequence:CCGGCGCTGCCTGTAGCAAGCTCATCTCGAGATGAGCTTGCTACAGGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207222.1-1823s1c1
Sequence:CCGGCCTGCCATTTACTTTAATCTTCTCGAGAAGATTAAAGTAAATGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207222.1-602s1c1
Sequence:CCGGAGGCCTCATGAAAGAAGGCTACTCGAGTAGCCTTCTTTCATGAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207222.1-395s1c1
Sequence:CCGGCAGAGACTATCTGAGGCTGTTCTCGAGAACAGCCTCAGATAGTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207222.1-370s1c1
Sequence:CCGGCGAAGGCTAACCTTATCCTTTCTCGAGAAAGGATAAGGTTAGCCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207222
LMO3 MISSION shRNA Lentiviral Transduction Particles
LIM domain only 3 (rhombotin-like 2)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207222.1-434s1c1
Sequence:CCGGCGCTGCCTGTAGCAAGCTCATCTCGAGATGAGCTTGCTACAGGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207222.1-1823s1c1
Sequence:CCGGCCTGCCATTTACTTTAATCTTCTCGAGAAGATTAAAGTAAATGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207222.1-602s1c1
Sequence:CCGGAGGCCTCATGAAAGAAGGCTACTCGAGTAGCCTTCTTTCATGAGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207222.1-395s1c1
Sequence:CCGGCAGAGACTATCTGAGGCTGTTCTCGAGAACAGCCTCAGATAGTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207222.1-370s1c1
Sequence:CCGGCGAAGGCTAACCTTATCCTTTCTCGAGAAAGGATAAGGTTAGCCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)