EMAIL THIS PAGE TO A FRIEND

LMO4

LIM domain only 4

108 Gene Product Result for
UniProtKB ID: P61968, D3DT23, O00158, O88894
Gene ID:
Human(8543) Summary: This gene encodes a cysteine-rich protein that contains two LIM domains but lacks a DNA-binding homeodomain. The encoded protein may play a role as a transcriptional regulator or as an oncogene. [provided by RefSeq, Aug 2008]
Mouse(16911) LIM domain only 4
Rat(362051) LIM domain only 4
domestic guinea pig(100725616) LIM domain only 4
sheep(101118065) LIM domain only 4
chicken(373901) LIM domain only 4
cow(614212) LIM domain only 4
domestic cat(101080812) LIM domain only 4
dog(479962) LIM domain only 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006769 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006769 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006769 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010723 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010723 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010723 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050081 MISSION® esiRNA esiRNA human LMO4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006769 Rosetta Predictions human pricing
NM_001009708 Rosetta Predictions rat pricing
NM_010723 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062356 predicted 1086
2 SASI_Hs01_00062357 predicted 1160
3 SASI_Hs01_00062358 predicted 953
4 SASI_Hs01_00062359 predicted 1089
5 SASI_Hs01_00062360 predicted 1255
6 SASI_Hs01_00062361 predicted 997
7 SASI_Hs01_00062362 predicted 1047
8 SASI_Hs01_00062363 predicted 1242
9 SASI_Hs01_00062364 predicted 1197
10 SASI_Hs01_00062365 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009708 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086265 predicted 676
2 SASI_Rn01_00086266 predicted 554
3 SASI_Rn01_00086267 predicted 532
4 SASI_Rn01_00086268 predicted 578
5 SASI_Rn01_00086269 predicted 680
6 SASI_Rn01_00086270 predicted 664
7 SASI_Rn01_00086271 predicted 635
8 SASI_Rn01_00086272 predicted 721
9 SASI_Rn01_00086273 predicted 781
10 SASI_Rn01_00086274 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107721 predicted 566
2 SASI_Mm01_00107722 predicted 551
3 SASI_Mm01_00107723 predicted 375
4 SASI_Mm01_00107724 predicted 352
5 SASI_Mm01_00107725 predicted 642
6 SASI_Mm01_00107726 predicted 502
7 SASI_Mm01_00107727 predicted 492
8 SASI_Mm01_00107728 predicted 400
9 SASI_Mm01_00107729 predicted 608
10 SASI_Mm01_00107730 predicted 502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006769
VALIDATED
LMO4 MISSION shRNA Bacterial Glycerol Stock
LIM domain only 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006769.2-1429s1c1
Sequence:CCGGCCGCATTTATTGGTGTATTAACTCGAGTTAATACACCAATAAATGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006769.2-1165s1c1
Sequence:CCGGCACTACATCAATGGCAGTTTACTCGAGTAAACTGCCATTGATGTAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006769.2-999s1c1
Sequence:CCGGCAGAAATGACTACATTAGGTTCTCGAGAACCTAATGTAGTCATTTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006769.2-1156s1c1
Sequence:CCGGGATCGGTTTCACTACATCAATCTCGAGATTGATGTAGTGAAACCGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006769.2-1087s1c1
Sequence:CCGGGCGCAAGGCAATGTGTATCATCTCGAGATGATACACATTGCCTTGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006769.3-1087s21c1
Sequence:CCGGGCGCAAGGCAATGTGTATCATCTCGAGATGATACACATTGCCTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006769.3-1156s21c1
Sequence:CCGGGATCGGTTTCACTACATCAATCTCGAGATTGATGTAGTGAAACCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006769.3-1707s21c1
Sequence:CCGGTGTTGTAAGGAAACGTGTTTCCTCGAGGAAACACGTTTCCTTACAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006769.3-999s21c1
Sequence:CCGGCAGAAATGACTACATTAGGTTCTCGAGAACCTAATGTAGTCATTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006769.3-887s21c1
Sequence:CCGGTCTATGCCATGGACAGCTATTCTCGAGAATAGCTGTCCATGGCATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006769
VALIDATED
LMO4 MISSION shRNA shRNA Plasmid DNA
LIM domain only 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006769.2-1429s1c1
Sequence:CCGGCCGCATTTATTGGTGTATTAACTCGAGTTAATACACCAATAAATGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006769.2-1165s1c1
Sequence:CCGGCACTACATCAATGGCAGTTTACTCGAGTAAACTGCCATTGATGTAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006769.2-999s1c1
Sequence:CCGGCAGAAATGACTACATTAGGTTCTCGAGAACCTAATGTAGTCATTTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006769.2-1156s1c1
Sequence:CCGGGATCGGTTTCACTACATCAATCTCGAGATTGATGTAGTGAAACCGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006769.2-1087s1c1
Sequence:CCGGGCGCAAGGCAATGTGTATCATCTCGAGATGATACACATTGCCTTGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006769.3-1087s21c1
Sequence:CCGGGCGCAAGGCAATGTGTATCATCTCGAGATGATACACATTGCCTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006769.3-1156s21c1
Sequence:CCGGGATCGGTTTCACTACATCAATCTCGAGATTGATGTAGTGAAACCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006769.3-1707s21c1
Sequence:CCGGTGTTGTAAGGAAACGTGTTTCCTCGAGGAAACACGTTTCCTTACAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006769.3-999s21c1
Sequence:CCGGCAGAAATGACTACATTAGGTTCTCGAGAACCTAATGTAGTCATTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006769.3-887s21c1
Sequence:CCGGTCTATGCCATGGACAGCTATTCTCGAGAATAGCTGTCCATGGCATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006769
VALIDATED
LMO4 MISSION shRNA Lentiviral Transduction Particles
LIM domain only 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006769.2-1429s1c1
Sequence:CCGGCCGCATTTATTGGTGTATTAACTCGAGTTAATACACCAATAAATGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006769.2-1165s1c1
Sequence:CCGGCACTACATCAATGGCAGTTTACTCGAGTAAACTGCCATTGATGTAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006769.2-999s1c1
Sequence:CCGGCAGAAATGACTACATTAGGTTCTCGAGAACCTAATGTAGTCATTTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006769.2-1156s1c1
Sequence:CCGGGATCGGTTTCACTACATCAATCTCGAGATTGATGTAGTGAAACCGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006769.2-1087s1c1
Sequence:CCGGGCGCAAGGCAATGTGTATCATCTCGAGATGATACACATTGCCTTGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006769.3-1087s21c1
Sequence:CCGGGCGCAAGGCAATGTGTATCATCTCGAGATGATACACATTGCCTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006769.3-1156s21c1
Sequence:CCGGGATCGGTTTCACTACATCAATCTCGAGATTGATGTAGTGAAACCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006769.3-1707s21c1
Sequence:CCGGTGTTGTAAGGAAACGTGTTTCCTCGAGGAAACACGTTTCCTTACAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006769.3-999s21c1
Sequence:CCGGCAGAAATGACTACATTAGGTTCTCGAGAACCTAATGTAGTCATTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006769.3-887s21c1
Sequence:CCGGTCTATGCCATGGACAGCTATTCTCGAGAATAGCTGTCCATGGCATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010723
VALIDATED
LMO4 MISSION shRNA Bacterial Glycerol Stock
LIM domain only 4
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010723.2-818s1c1
Sequence:CCGGCCTGCATTTATTGGTGTATTACTCGAGTAATACACCAATAAATGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010723.2-500s1c1
Sequence:CCGGCGTGTATCATCTCAAGTGTTTCTCGAGAAACACTTGAGATGATACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010723.2-499s1c1
Sequence:CCGGACGTGTATCATCTCAAGTGTTCTCGAGAACACTTGAGATGATACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010723.2-396s1c1
Sequence:CCGGCTTTGCAGAAATGACTACATTCTCGAGAATGTAGTCATTTCTGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010723.2-395s1c1
Sequence:CCGGCCTTTGCAGAAATGACTACATCTCGAGATGTAGTCATTTCTGCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.3-1261s21c1
Sequence:CCGGTCTACCCTCATTAACAATTAGCTCGAGCTAATTGTTAATGAGGGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.3-614s21c1
Sequence:CCGGGACATTGGCACGTCCTGTTACCTCGAGGTAACAGGACGTGCCAATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010723.3-780s21c1
Sequence:CCGGCATGTTCTACCTGCCGGAATCCTCGAGGATTCCGGCAGGTAGAACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232246    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.2-807s21c1
Sequence:CCGGTGAGTACCCTTCCTGCATTTACTCGAGTAAATGCAGGAAGGGTACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.2-570s21c1
Sequence:CCGGTACATCAATGGCAGTTTATTTCTCGAGAAATAAACTGCCATTGATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.2-501s21c1
Sequence:CCGGGTGTATCATCTCAAGTGTTTCCTCGAGGAAACACTTGAGATGATACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.2-406s21c1
Sequence:CCGGATGACTACATTAGGTTATTTGCTCGAGCAAATAACCTAATGTAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.2-611s21c1
Sequence:CCGGAGCCCTCATCAATGGCCATTTCTCGAGAAATGGCCATTGATGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010723
VALIDATED
LMO4 MISSION shRNA shRNA Plasmid DNA
LIM domain only 4
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010723.2-818s1c1
Sequence:CCGGCCTGCATTTATTGGTGTATTACTCGAGTAATACACCAATAAATGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010723.2-500s1c1
Sequence:CCGGCGTGTATCATCTCAAGTGTTTCTCGAGAAACACTTGAGATGATACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010723.2-499s1c1
Sequence:CCGGACGTGTATCATCTCAAGTGTTCTCGAGAACACTTGAGATGATACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010723.2-396s1c1
Sequence:CCGGCTTTGCAGAAATGACTACATTCTCGAGAATGTAGTCATTTCTGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010723.2-395s1c1
Sequence:CCGGCCTTTGCAGAAATGACTACATCTCGAGATGTAGTCATTTCTGCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.3-1261s21c1
Sequence:CCGGTCTACCCTCATTAACAATTAGCTCGAGCTAATTGTTAATGAGGGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.3-614s21c1
Sequence:CCGGGACATTGGCACGTCCTGTTACCTCGAGGTAACAGGACGTGCCAATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010723.3-780s21c1
Sequence:CCGGCATGTTCTACCTGCCGGAATCCTCGAGGATTCCGGCAGGTAGAACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232246    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.2-807s21c1
Sequence:CCGGTGAGTACCCTTCCTGCATTTACTCGAGTAAATGCAGGAAGGGTACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.2-570s21c1
Sequence:CCGGTACATCAATGGCAGTTTATTTCTCGAGAAATAAACTGCCATTGATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.2-501s21c1
Sequence:CCGGGTGTATCATCTCAAGTGTTTCCTCGAGGAAACACTTGAGATGATACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.2-406s21c1
Sequence:CCGGATGACTACATTAGGTTATTTGCTCGAGCAAATAACCTAATGTAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.2-611s21c1
Sequence:CCGGAGCCCTCATCAATGGCCATTTCTCGAGAAATGGCCATTGATGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010723
VALIDATED
LMO4 MISSION shRNA Lentiviral Transduction Particles
LIM domain only 4
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010723.2-818s1c1
Sequence:CCGGCCTGCATTTATTGGTGTATTACTCGAGTAATACACCAATAAATGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010723.2-500s1c1
Sequence:CCGGCGTGTATCATCTCAAGTGTTTCTCGAGAAACACTTGAGATGATACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010723.2-499s1c1
Sequence:CCGGACGTGTATCATCTCAAGTGTTCTCGAGAACACTTGAGATGATACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010723.2-396s1c1
Sequence:CCGGCTTTGCAGAAATGACTACATTCTCGAGAATGTAGTCATTTCTGCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010723.2-395s1c1
Sequence:CCGGCCTTTGCAGAAATGACTACATCTCGAGATGTAGTCATTTCTGCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.3-1261s21c1
Sequence:CCGGTCTACCCTCATTAACAATTAGCTCGAGCTAATTGTTAATGAGGGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.3-614s21c1
Sequence:CCGGGACATTGGCACGTCCTGTTACCTCGAGGTAACAGGACGTGCCAATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010723.3-780s21c1
Sequence:CCGGCATGTTCTACCTGCCGGAATCCTCGAGGATTCCGGCAGGTAGAACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232246    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.2-807s21c1
Sequence:CCGGTGAGTACCCTTCCTGCATTTACTCGAGTAAATGCAGGAAGGGTACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.2-570s21c1
Sequence:CCGGTACATCAATGGCAGTTTATTTCTCGAGAAATAAACTGCCATTGATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.2-501s21c1
Sequence:CCGGGTGTATCATCTCAAGTGTTTCCTCGAGGAAACACTTGAGATGATACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.2-406s21c1
Sequence:CCGGATGACTACATTAGGTTATTTGCTCGAGCAAATAACCTAATGTAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010723.2-611s21c1
Sequence:CCGGAGCCCTCATCAATGGCCATTTCTCGAGAAATGGCCATTGATGAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)