EMAIL THIS PAGE TO A FRIEND

LMO7

LIM domain 7

278 Gene Product Result for
Synonyms: FBX20 FBXO20 LOMP
Gene ID:
Human(4008) Summary: This gene encodes a protein containing a calponin homology (CH) domain, a PDZ domain, and a LIM domain, and may be involved in protein-protein interactions. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene, however, the full-length nature of some variants is not known. [provided by RefSeq, Jan 2009]
Mouse(380928) LIM domain only 7
Rat(361084) LIM domain 7
chicken(418815) LIM domain 7
dog(476948) LIM domain 7
Horse(100052118) LIM domain 7
cow(539359) LIM domain 7
sheep(101102742) LIM domain 7
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005358 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201529 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201529 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201529 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005358 Rosetta Predictions human pricing
NM_001001515 Rosetta Predictions rat pricing
XM_579059 Rosetta Predictions rat pricing
NM_201529 Rosetta Predictions mouse pricing
XM_001004521 Rosetta Predictions mouse pricing
XM_895685 Rosetta Predictions mouse pricing
XM_895694 Rosetta Predictions mouse pricing
XM_895707 Rosetta Predictions mouse pricing
XM_895719 Rosetta Predictions mouse pricing
XM_895728 Rosetta Predictions mouse pricing
XM_895740 Rosetta Predictions mouse pricing
XM_895756 Rosetta Predictions mouse pricing
XM_895767 Rosetta Predictions mouse pricing
XM_895783 Rosetta Predictions mouse pricing
XM_905039 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246134 predicted 3370
2 SASI_Hs01_00246135 predicted 1789
3 SASI_Hs02_00339449 predicted 2971
4 SASI_Hs02_00339450 predicted 5087
5 SASI_Hs01_00246136 predicted 3269
6 SASI_Hs01_00246138 predicted 2004
7 SASI_Hs01_00246139 predicted 4536
8 SASI_Hs01_00246141 predicted 2965
9 SASI_Hs02_00339451 predicted 1590
10 SASI_Hs01_00246143 predicted 1710
11 SASI_Hs01_00246137 predicted 1557
12 SASI_Hs01_00246140 predicted 1618
13 SASI_Hs01_00246142 predicted 4067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001515 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076649 predicted 393
2 SASI_Rn01_00076650 predicted 4937
3 SASI_Rn01_00076651 predicted 3517
4 SASI_Rn01_00076652 predicted 2888
5 SASI_Rn01_00076653 predicted 4480
6 SASI_Rn01_00076654 predicted 2154
7 SASI_Rn01_00076655 predicted 3190
8 SASI_Rn01_00076656 predicted 273
9 SASI_Rn01_00076657 predicted 511
10 SASI_Rn01_00076658 predicted 4346
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579059 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144178 predicted 3168
2 SASI_Rn01_00144179 predicted 2565
3 SASI_Rn01_00144180 predicted 3166
4 SASI_Rn01_00144181 predicted 2548
5 SASI_Rn01_00144182 predicted 3171
6 SASI_Rn01_00144183 predicted 3160
7 SASI_Rn01_00144184 predicted 3169
8 SASI_Rn01_00144185 predicted 2598
9 SASI_Rn01_00144186 predicted 2530
10 SASI_Rn01_00144187 predicted 2539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351595 predicted 3717
2 SASI_Mm02_00351596 predicted 622
3 SASI_Mm02_00351597 predicted 3322
4 SASI_Mm02_00351598 predicted 1549
5 SASI_Mm02_00351599 predicted 1381
6 SASI_Mm02_00351600 predicted 360
7 SASI_Mm02_00351601 predicted 508
8 SASI_Mm02_00351602 predicted 4718
9 SASI_Mm02_00351603 predicted 373
10 SASI_Mm02_00351604 predicted 1746
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004521 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275224 predicted 3715
2 SASI_Mm01_00275225 predicted 2870
3 SASI_Mm01_00275226 predicted 2079
4 SASI_Mm01_00275227 predicted 2478
5 SASI_Mm01_00275228 predicted 714
6 SASI_Mm01_00275229 predicted 1758
7 SASI_Mm01_00275230 predicted 537
8 SASI_Mm01_00275231 predicted 3884
9 SASI_Mm01_00275232 predicted 2812
10 SASI_Mm01_00275233 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249062 predicted 2321
2 SASI_Mm01_00249063 predicted 1482
3 SASI_Mm01_00249064 predicted 690
4 SASI_Mm01_00249065 predicted 1094
5 SASI_Mm01_00249066 predicted 1346
6 SASI_Mm01_00249067 predicted 367
7 SASI_Mm01_00249068 predicted 2488
8 SASI_Mm01_00249069 predicted 1887
9 SASI_Mm01_00249070 predicted 1418
10 SASI_Mm01_00249071 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895694 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225579 predicted 1663
2 SASI_Mm01_00225580 predicted 2376
3 SASI_Mm01_00225581 predicted 2073
4 SASI_Mm01_00225582 predicted 1348
5 SASI_Mm01_00225583 predicted 2467
6 SASI_Mm01_00225584 predicted 1174
7 SASI_Mm01_00225585 predicted 2442
8 SASI_Mm01_00225586 predicted 2204
9 SASI_Mm01_00225587 predicted 704
10 SASI_Mm01_00225588 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895707 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241517 predicted 1046
2 SASI_Mm01_00241518 predicted 277
3 SASI_Mm01_00241519 predicted 826
4 SASI_Mm01_00241520 predicted 710
5 SASI_Mm01_00241521 predicted 762
6 SASI_Mm01_00241522 predicted 488
7 SASI_Mm01_00241523 predicted 546
8 SASI_Mm01_00241524 predicted 643
9 SASI_Mm01_00241525 predicted 349
10 SASI_Mm01_00241526 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234077 predicted 3349
2 SASI_Mm01_00234078 predicted 2506
3 SASI_Mm01_00234079 predicted 1708
4 SASI_Mm01_00234080 predicted 2107
5 SASI_Mm01_00234081 predicted 2370
6 SASI_Mm01_00234082 predicted 1394
7 SASI_Mm01_00234083 predicted 3507
8 SASI_Mm01_00234084 predicted 2897
9 SASI_Mm01_00234085 predicted 2435
10 SASI_Mm01_00234086 predicted 2425
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895728 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210346 predicted 2122
2 SASI_Mm01_00210347 predicted 1654
3 SASI_Mm01_00210348 predicted 1701
4 SASI_Mm01_00210349 predicted 2192
5 SASI_Mm01_00210350 predicted 2475
6 SASI_Mm01_00210351 predicted 2519
7 SASI_Mm01_00210352 predicted 2120
8 SASI_Mm01_00210353 predicted 2415
9 SASI_Mm01_00210354 predicted 2453
10 SASI_Mm01_00210355 predicted 2436
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895740 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204251 predicted 2943
2 SASI_Mm01_00204252 predicted 3342
3 SASI_Mm01_00204253 predicted 1575
4 SASI_Mm01_00204254 predicted 1406
5 SASI_Mm01_00204255 predicted 382
6 SASI_Mm01_00204256 predicted 526
7 SASI_Mm01_00204257 predicted 4748
8 SASI_Mm01_00204258 predicted 394
9 SASI_Mm01_00204259 predicted 1769
10 SASI_Mm01_00204260 predicted 3653
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265299 predicted 3336
2 SASI_Mm01_00265300 predicted 2589
3 SASI_Mm01_00265301 predicted 1786
4 SASI_Mm01_00265302 predicted 645
5 SASI_Mm01_00265303 predicted 2200
6 SASI_Mm01_00265304 predicted 1618
7 SASI_Mm01_00265305 predicted 380
8 SASI_Mm01_00265306 predicted 524
9 SASI_Mm01_00265307 predicted 3498
10 SASI_Mm01_00265308 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895767 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266906 predicted 4579
2 SASI_Mm01_00266907 predicted 3735
3 SASI_Mm01_00266908 predicted 2942
4 SASI_Mm01_00266909 predicted 3344
5 SASI_Mm01_00266910 predicted 3608
6 SASI_Mm01_00266911 predicted 2629
7 SASI_Mm01_00266912 predicted 4751
8 SASI_Mm01_00266913 predicted 4135
9 SASI_Mm01_00266914 predicted 3671
10 SASI_Mm01_00266915 predicted 3657
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230863 predicted 4205
2 SASI_Mm01_00230864 predicted 3369
3 SASI_Mm01_00230865 predicted 2570
4 SASI_Mm01_00230866 predicted 2976
5 SASI_Mm01_00230867 predicted 1200
6 SASI_Mm01_00230868 predicted 2258
7 SASI_Mm01_00230869 predicted 1038
8 SASI_Mm01_00230870 predicted 4375
9 SASI_Mm01_00230871 predicted 3305
10 SASI_Mm01_00230872 predicted 1390
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905039 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221306 predicted 2941
2 SASI_Mm01_00221307 predicted 646
3 SASI_Mm01_00221308 predicted 3341
4 SASI_Mm01_00221309 predicted 1570
5 SASI_Mm01_00221310 predicted 1403
6 SASI_Mm01_00221311 predicted 386
7 SASI_Mm01_00221312 predicted 531
8 SASI_Mm01_00221313 predicted 4740
9 SASI_Mm01_00221314 predicted 397
10 SASI_Mm01_00221315 predicted 1767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005358
VALIDATED
LMO7 MISSION shRNA Bacterial Glycerol Stock
LIM domain 7
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005358.5-2284s21c1
Sequence:CCGGAGTTGGGCAAGCCCGGTTTATCTCGAGATAAACCGGGCTTGCCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005358.5-2087s21c1
Sequence:CCGGGTGACACAGATTCGGAATTTACTCGAGTAAATTCCGAATCTGTGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005358.5-4647s21c1
Sequence:CCGGAGAATTGGAGAGGCAACAAATCTCGAGATTTGTTGCCTCTCCAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005358.5-2583s21c1
Sequence:CCGGGAGAAGCTCTAAGACGTTTAACTCGAGTTAAACGTCTTAGAGCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005358.5-5465s21c1
Sequence:CCGGGTCTTGGTAGAACCAGTATTTCTCGAGAAATACTGGTTCTACCAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005358.5-1799s21c1
Sequence:CCGGCACAAAGCAACCCGTACTATACTCGAGTATAGTACGGGTTGCTTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005358.3-5151s1c1
Sequence:CCGGCCTGGGTCTTTGTTATCATTTCTCGAGAAATGATAACAAAGACCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005358.3-1580s1c1
Sequence:CCGGGCGTCATTAAGAAGATCAATACTCGAGTATTGATCTTCTTAATGACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005358.3-3526s1c1
Sequence:CCGGGCTATTAACAACACCAAGTTTCTCGAGAAACTTGGTGTTGTTAATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005358.3-2296s1c1
Sequence:CCGGCCGGTTTATACAGAAGCAGATCTCGAGATCTGCTTCTGTATAAACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005358.3-5436s1c1
Sequence:CCGGGCCTCTTTAGATTACATAGAACTCGAGTTCTATGTAATCTAAAGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005358
VALIDATED
LMO7 MISSION shRNA shRNA Plasmid DNA
LIM domain 7
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005358.5-2284s21c1
Sequence:CCGGAGTTGGGCAAGCCCGGTTTATCTCGAGATAAACCGGGCTTGCCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005358.5-2087s21c1
Sequence:CCGGGTGACACAGATTCGGAATTTACTCGAGTAAATTCCGAATCTGTGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005358.5-4647s21c1
Sequence:CCGGAGAATTGGAGAGGCAACAAATCTCGAGATTTGTTGCCTCTCCAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005358.5-2583s21c1
Sequence:CCGGGAGAAGCTCTAAGACGTTTAACTCGAGTTAAACGTCTTAGAGCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005358.5-5465s21c1
Sequence:CCGGGTCTTGGTAGAACCAGTATTTCTCGAGAAATACTGGTTCTACCAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005358.5-1799s21c1
Sequence:CCGGCACAAAGCAACCCGTACTATACTCGAGTATAGTACGGGTTGCTTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005358.3-5151s1c1
Sequence:CCGGCCTGGGTCTTTGTTATCATTTCTCGAGAAATGATAACAAAGACCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005358.3-1580s1c1
Sequence:CCGGGCGTCATTAAGAAGATCAATACTCGAGTATTGATCTTCTTAATGACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005358.3-3526s1c1
Sequence:CCGGGCTATTAACAACACCAAGTTTCTCGAGAAACTTGGTGTTGTTAATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005358.3-2296s1c1
Sequence:CCGGCCGGTTTATACAGAAGCAGATCTCGAGATCTGCTTCTGTATAAACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005358.3-5436s1c1
Sequence:CCGGGCCTCTTTAGATTACATAGAACTCGAGTTCTATGTAATCTAAAGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005358
VALIDATED
LMO7 MISSION shRNA Lentiviral Transduction Particles
LIM domain 7
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005358.5-2284s21c1
Sequence:CCGGAGTTGGGCAAGCCCGGTTTATCTCGAGATAAACCGGGCTTGCCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005358.5-2087s21c1
Sequence:CCGGGTGACACAGATTCGGAATTTACTCGAGTAAATTCCGAATCTGTGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005358.5-4647s21c1
Sequence:CCGGAGAATTGGAGAGGCAACAAATCTCGAGATTTGTTGCCTCTCCAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005358.5-2583s21c1
Sequence:CCGGGAGAAGCTCTAAGACGTTTAACTCGAGTTAAACGTCTTAGAGCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005358.5-5465s21c1
Sequence:CCGGGTCTTGGTAGAACCAGTATTTCTCGAGAAATACTGGTTCTACCAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005358.5-1799s21c1
Sequence:CCGGCACAAAGCAACCCGTACTATACTCGAGTATAGTACGGGTTGCTTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005358.3-5151s1c1
Sequence:CCGGCCTGGGTCTTTGTTATCATTTCTCGAGAAATGATAACAAAGACCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005358.3-1580s1c1
Sequence:CCGGGCGTCATTAAGAAGATCAATACTCGAGTATTGATCTTCTTAATGACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005358.3-3526s1c1
Sequence:CCGGGCTATTAACAACACCAAGTTTCTCGAGAAACTTGGTGTTGTTAATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005358.3-2296s1c1
Sequence:CCGGCCGGTTTATACAGAAGCAGATCTCGAGATCTGCTTCTGTATAAACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005358.3-5436s1c1
Sequence:CCGGGCCTCTTTAGATTACATAGAACTCGAGTTCTATGTAATCTAAAGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201529
VALIDATED
LMO7 MISSION shRNA Bacterial Glycerol Stock
LIM domain 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201529.2-5286s21c1
Sequence:CCGGACTGCTATCTCCGATTCAAATCTCGAGATTTGAATCGGAGATAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201529.2-4477s21c1
Sequence:CCGGGTACCGAAGGCCCATTGATTCCTCGAGGAATCAATGGGCCTTCGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201529.2-429s21c1
Sequence:CCGGTAGCAGGTTTGGATAACATAACTCGAGTTATGTTATCCAAACCTGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201529.2-5449s21c1
Sequence:CCGGATAATCATTGCCTCGTTAAATCTCGAGATTTAACGAGGCAATGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201529.2-1704s21c1
Sequence:CCGGATGCCGTGGAACGAGATATAACTCGAGTTATATCTCGTTCCACGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201529
VALIDATED
LMO7 MISSION shRNA shRNA Plasmid DNA
LIM domain 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201529.2-5286s21c1
Sequence:CCGGACTGCTATCTCCGATTCAAATCTCGAGATTTGAATCGGAGATAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201529.2-4477s21c1
Sequence:CCGGGTACCGAAGGCCCATTGATTCCTCGAGGAATCAATGGGCCTTCGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201529.2-429s21c1
Sequence:CCGGTAGCAGGTTTGGATAACATAACTCGAGTTATGTTATCCAAACCTGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201529.2-5449s21c1
Sequence:CCGGATAATCATTGCCTCGTTAAATCTCGAGATTTAACGAGGCAATGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201529.2-1704s21c1
Sequence:CCGGATGCCGTGGAACGAGATATAACTCGAGTTATATCTCGTTCCACGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201529
VALIDATED
LMO7 MISSION shRNA Lentiviral Transduction Particles
LIM domain 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201529.2-5286s21c1
Sequence:CCGGACTGCTATCTCCGATTCAAATCTCGAGATTTGAATCGGAGATAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201529.2-4477s21c1
Sequence:CCGGGTACCGAAGGCCCATTGATTCCTCGAGGAATCAATGGGCCTTCGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201529.2-429s21c1
Sequence:CCGGTAGCAGGTTTGGATAACATAACTCGAGTTATGTTATCCAAACCTGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201529.2-5449s21c1
Sequence:CCGGATAATCATTGCCTCGTTAAATCTCGAGATTTAACGAGGCAATGATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201529.2-1704s21c1
Sequence:CCGGATGCCGTGGAACGAGATATAACTCGAGTTATATCTCGTTCCACGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)