EMAIL THIS PAGE TO A FRIEND

LMOD1

leiomodin 1 (smooth muscle)

161 Gene Product Result for
Synonyms: 1D 64kD D1 SM-LMOD
UniProtKB ID: P29536, B1APV6, C4AMB1, Q68EN2
Gene ID:
Human(25802) Summary: The leiomodin 1 protein has a putative membrane-spanning region and 2 types of tandemly repeated blocks. The transcript is expressed in all tissues tested, with the highest levels in thyroid, eye muscle, skeletal muscle, and ovary. Increased expression of leiomodin 1 may be linked to Graves' disease and thyroid-associated ophthalmopathy. [provided by RefSeq, Jul 2008]
Mouse(93689) leiomodin 1 (smooth muscle)
Rat(304816) leiomodin 1 (smooth muscle)
Zebrafish(100002383) leiomodin 1 (smooth muscle)
cow(532090) leiomodin 1 (smooth muscle)
Horse(100052019) leiomodin 1 (smooth muscle)
domestic cat(101100358) leiomodin 1 (smooth muscle)
dog(490237) leiomodin 1 (smooth muscle)
chicken(771476) leiomodin 1 (smooth muscle)
domestic guinea pig(100732130) leiomodin 1 (smooth muscle)
naked mole-rat(101718408) leiomodin 1 (smooth muscle)
sheep(101113691) leiomodin 1 (smooth muscle)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407254 Anti-LMOD1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2101354 Anti-LMOD1 antibody produced in rabbit affinity isolated antibody mouse, human, bovine, guinea pig, horse, rat, rabbit
western blot pricing
SAB4200200 Anti-LMOD1 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
HPA028325 Anti-LMOD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
HPA028435 Anti-LMOD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
HPA030097 Anti-LMOD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab3 Antibody Enhanced Validation human
immunohistochemistry pricing
SAB2107079 Anti-LMOD1 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, rabbit, human, horse
western blot pricing
SAB4200496 Monoclonal Anti-LMOD1 antibody produced in mouse ~1.0 mg/mL, clone LMOD1-12, purified immunoglobulin mouse, rat, human
western blot pricing
SAB1401605 Monoclonal Anti-LMOD1 antibody produced in mouse clone 3B8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012134 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012134 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012134 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053106 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053106 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053106 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012134 Rosetta Predictions human pricing
NM_001107179 Rosetta Predictions rat pricing
NM_053106 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343685 predicted 1584
2 SASI_Hs02_00343686 predicted 2268
3 SASI_Hs02_00343687 predicted 1542
4 SASI_Hs02_00343688 predicted 2199
5 SASI_Hs01_00038867 predicted 1189
6 SASI_Hs02_00343689 predicted 416
7 SASI_Hs02_00343690 predicted 1378
8 SASI_Hs01_00038869 predicted 1256
9 SASI_Hs02_00343691 predicted 2359
10 SASI_Hs02_00343692 predicted 1358
11 SASI_Hs01_00038865 predicted 1690
12 SASI_Hs01_00038866 predicted 1143
13 SASI_Hs01_00038868 predicted 1520
14 SASI_Hs01_00038870 predicted 2095
15 SASI_Hs01_00038871 predicted 1163
16 SASI_Hs01_00038872 predicted 1502
17 SASI_Hs01_00038873 predicted 1599
18 SASI_Hs01_00038874 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107179 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226285 predicted 1767
2 SASI_Rn02_00226286 predicted 1574
3 SASI_Rn02_00226287 predicted 1604
4 SASI_Rn02_00226288 predicted 1193
5 SASI_Rn02_00226289 predicted 1008
6 SASI_Rn02_00226290 predicted 1128
7 SASI_Rn02_00226291 predicted 828
8 SASI_Rn02_00226292 predicted 1267
9 SASI_Rn02_00226293 predicted 1376
10 SASI_Rn02_00226294 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053106 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085224 predicted 1312
2 SASI_Mm01_00085225 predicted 1080
3 SASI_Mm01_00085226 predicted 1260
4 SASI_Mm01_00085227 predicted 1120
5 SASI_Mm01_00085229 predicted 442
6 SASI_Mm01_00085230 predicted 1435
7 SASI_Mm01_00085231 predicted 355
8 SASI_Mm01_00085232 predicted 845
9 SASI_Mm01_00085233 predicted 1014
10 SASI_Mm02_00337618 predicted 1366
11 SASI_Mm01_00085228 predicted 1193
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012134
LMOD1 MISSION shRNA Bacterial Glycerol Stock
leiomodin 1 (smooth muscle)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113866    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012134.1-2599s1c1
Sequence:CCGGGCTGTATGAATAGCTGTGTATCTCGAGATACACAGCTATTCATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012134.1-1136s1c1
Sequence:CCGGCGTCAACAACTCAGACTGCATCTCGAGATGCAGTCTGAGTTGTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012134.1-1071s1c1
Sequence:CCGGCCCAGCATATTTGATGAGCCTCTCGAGAGGCTCATCAAATATGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012134.1-1759s1c1
Sequence:CCGGCCCTTATCATGGAGAACCTGACTCGAGTCAGGTTCTCCATGATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012134.1-1685s1c1
Sequence:CCGGCTCTCCAAAGAACTCACCCAACTCGAGTTGGGTGAGTTCTTTGGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012134.2-1640s21c1
Sequence:CCGGCAATCTGCTCAGCCGCAACATCTCGAGATGTTGCGGCTGAGCAGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012134.2-2241s21c1
Sequence:CCGGTCTCTGAGGCTCTCCAAATTTCTCGAGAAATTTGGAGAGCCTCAGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012134.2-2211s21c1
Sequence:CCGGGCCTTATCTCTTCTCACTTTCCTCGAGGAAAGTGAGAAGAGATAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012134.2-1282s21c1
Sequence:CCGGATGAGATCTTGGTCCGGTTTACTCGAGTAAACCGGACCAAGATCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012134
LMOD1 MISSION shRNA shRNA Plasmid DNA
leiomodin 1 (smooth muscle)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113866    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012134.1-2599s1c1
Sequence:CCGGGCTGTATGAATAGCTGTGTATCTCGAGATACACAGCTATTCATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012134.1-1136s1c1
Sequence:CCGGCGTCAACAACTCAGACTGCATCTCGAGATGCAGTCTGAGTTGTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012134.1-1071s1c1
Sequence:CCGGCCCAGCATATTTGATGAGCCTCTCGAGAGGCTCATCAAATATGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012134.1-1759s1c1
Sequence:CCGGCCCTTATCATGGAGAACCTGACTCGAGTCAGGTTCTCCATGATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012134.1-1685s1c1
Sequence:CCGGCTCTCCAAAGAACTCACCCAACTCGAGTTGGGTGAGTTCTTTGGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012134.2-1640s21c1
Sequence:CCGGCAATCTGCTCAGCCGCAACATCTCGAGATGTTGCGGCTGAGCAGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012134.2-2241s21c1
Sequence:CCGGTCTCTGAGGCTCTCCAAATTTCTCGAGAAATTTGGAGAGCCTCAGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012134.2-2211s21c1
Sequence:CCGGGCCTTATCTCTTCTCACTTTCCTCGAGGAAAGTGAGAAGAGATAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012134.2-1282s21c1
Sequence:CCGGATGAGATCTTGGTCCGGTTTACTCGAGTAAACCGGACCAAGATCTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012134
LMOD1 MISSION shRNA Lentiviral Transduction Particles
leiomodin 1 (smooth muscle)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113866    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012134.1-2599s1c1
Sequence:CCGGGCTGTATGAATAGCTGTGTATCTCGAGATACACAGCTATTCATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012134.1-1136s1c1
Sequence:CCGGCGTCAACAACTCAGACTGCATCTCGAGATGCAGTCTGAGTTGTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012134.1-1071s1c1
Sequence:CCGGCCCAGCATATTTGATGAGCCTCTCGAGAGGCTCATCAAATATGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012134.1-1759s1c1
Sequence:CCGGCCCTTATCATGGAGAACCTGACTCGAGTCAGGTTCTCCATGATAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012134.1-1685s1c1
Sequence:CCGGCTCTCCAAAGAACTCACCCAACTCGAGTTGGGTGAGTTCTTTGGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012134.2-1640s21c1
Sequence:CCGGCAATCTGCTCAGCCGCAACATCTCGAGATGTTGCGGCTGAGCAGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012134.2-2241s21c1
Sequence:CCGGTCTCTGAGGCTCTCCAAATTTCTCGAGAAATTTGGAGAGCCTCAGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012134.2-2211s21c1
Sequence:CCGGGCCTTATCTCTTCTCACTTTCCTCGAGGAAAGTGAGAAGAGATAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012134.2-1282s21c1
Sequence:CCGGATGAGATCTTGGTCCGGTTTACTCGAGTAAACCGGACCAAGATCTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053106
LMOD1 MISSION shRNA Bacterial Glycerol Stock
leiomodin 1 (smooth muscle)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053106.1-3303s1c1
Sequence:CCGGCGGCACGATTTCTTTCTGATTCTCGAGAATCAGAAAGAAATCGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053106.1-1123s1c1
Sequence:CCGGGCTCCCAGCATATTTGATGAACTCGAGTTCATCAAATATGCTGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053106.1-1814s1c1
Sequence:CCGGCCCTTATCATGGAGAACCTAACTCGAGTTAGGTTCTCCATGATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053106.1-1925s1c1
Sequence:CCGGCCATCCGTTCTAGCAACCTTACTCGAGTAAGGTTGCTAGAACGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053106.1-348s1c1
Sequence:CCGGGCAGAGGAATCAAACGGACAACTCGAGTTGTCCGTTTGATTCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053106
LMOD1 MISSION shRNA shRNA Plasmid DNA
leiomodin 1 (smooth muscle)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053106.1-3303s1c1
Sequence:CCGGCGGCACGATTTCTTTCTGATTCTCGAGAATCAGAAAGAAATCGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053106.1-1123s1c1
Sequence:CCGGGCTCCCAGCATATTTGATGAACTCGAGTTCATCAAATATGCTGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053106.1-1814s1c1
Sequence:CCGGCCCTTATCATGGAGAACCTAACTCGAGTTAGGTTCTCCATGATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053106.1-1925s1c1
Sequence:CCGGCCATCCGTTCTAGCAACCTTACTCGAGTAAGGTTGCTAGAACGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053106.1-348s1c1
Sequence:CCGGGCAGAGGAATCAAACGGACAACTCGAGTTGTCCGTTTGATTCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053106
LMOD1 MISSION shRNA Lentiviral Transduction Particles
leiomodin 1 (smooth muscle)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053106.1-3303s1c1
Sequence:CCGGCGGCACGATTTCTTTCTGATTCTCGAGAATCAGAAAGAAATCGTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053106.1-1123s1c1
Sequence:CCGGGCTCCCAGCATATTTGATGAACTCGAGTTCATCAAATATGCTGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053106.1-1814s1c1
Sequence:CCGGCCCTTATCATGGAGAACCTAACTCGAGTTAGGTTCTCCATGATAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053106.1-1925s1c1
Sequence:CCGGCCATCCGTTCTAGCAACCTTACTCGAGTAAGGTTGCTAGAACGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053106.1-348s1c1
Sequence:CCGGGCAGAGGAATCAAACGGACAACTCGAGTTGTCCGTTTGATTCCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)