EMAIL THIS PAGE TO A FRIEND

LMOD2

leiomodin 2 (cardiac)

70 Gene Product Result for
Synonyms: C-LMOD
UniProtKB ID: Q6P5Q4, A4D0W9, A4D0Y2, Q8WVJ8
Gene ID:
Mouse(93677) leiomodin 2 (cardiac)
Rat(296935) leiomodin 2 (cardiac)
sheep(101106254) leiomodin 2 (cardiac)
Domestic Rabbit(100348062) leiomodin 2 (cardiac)
domestic guinea pig(100723946) leiomodin 2 (cardiac)
naked mole-rat(101700956) leiomodin 2 (cardiac)
chicken(417751) leiomodin 2 (cardiac)
Horse(100056473) leiomodin 2 (cardiac)
cow(521024) leiomodin 2 (cardiac)
domestic cat(101094999) leiomodin 2 (cardiac)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207163 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207163 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207163 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_132983 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_132983 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_132983 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055841 MISSION® esiRNA esiRNA human LMOD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207163 Rosetta Predictions human pricing
XM_371949 Rosetta Predictions human pricing
NM_001100964 Rosetta Predictions rat pricing
NM_053098 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373783 predicted 1823
2 SASI_Hs02_00373784 predicted 928
3 SASI_Hs02_00373785 predicted 956
4 SASI_Hs02_00373786 predicted 1916
5 SASI_Hs02_00373787 predicted 271
6 SASI_Hs02_00373788 predicted 977
7 SASI_Hs02_00373789 predicted 836
8 SASI_Hs02_00373790 predicted 833
9 SASI_Hs02_00373791 predicted 848
10 SASI_Hs02_00373792 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273689 predicted 856
2 SASI_Hs01_00273690 predicted 879
3 SASI_Hs01_00273691 predicted 1095
4 SASI_Hs01_00273692 predicted 677
5 SASI_Hs01_00273693 predicted 705
6 SASI_Hs01_00273694 predicted 702
7 SASI_Hs01_00273695 predicted 906
8 SASI_Hs01_00273696 predicted 696
9 SASI_Hs01_00273697 predicted 747
10 SASI_Hs01_00273698 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210782 predicted 837
2 SASI_Rn02_00210783 predicted 1173
3 SASI_Rn02_00210784 predicted 1833
4 SASI_Rn02_00210785 predicted 1811
5 SASI_Rn02_00210786 predicted 920
6 SASI_Rn02_00210787 predicted 1834
7 SASI_Rn02_00210788 predicted 961
8 SASI_Rn02_00210789 predicted 862
9 SASI_Rn02_00210790 predicted 1705
10 SASI_Rn02_00210791 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053098 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097582 predicted 811
2 SASI_Mm01_00097583 predicted 892
3 SASI_Mm01_00097584 predicted 218
4 SASI_Mm01_00097585 predicted 906
5 SASI_Mm01_00097586 predicted 927
6 SASI_Mm01_00097587 predicted 764
7 SASI_Mm01_00097588 predicted 1050
8 SASI_Mm01_00097589 predicted 939
9 SASI_Mm01_00097590 predicted 830
10 SASI_Mm02_00337598 predicted 1670
11 SASI_Mm01_00097591 predicted 225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207163
LMOD2 MISSION shRNA Bacterial Glycerol Stock
leiomodin 2 (cardiac)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207163.1-1827s21c1
Sequence:CCGGAGAACTGTTCAGTGGTATTACCTCGAGGTAATACCACTGAACAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207163.1-1308s21c1
Sequence:CCGGCACCTAGCTCTTCACCTTATGCTCGAGCATAAGGTGAAGAGCTAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207163.1-978s21c1
Sequence:CCGGACGTCGAGTCCAACTTCATAACTCGAGTTATGAAGTTGGACTCGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207163.1-758s21c1
Sequence:CCGGGACGCTTTGGACAAGATTAAACTCGAGTTTAATCTTGTCCAAAGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207163.1-1179s21c1
Sequence:CCGGGAATGAGCATGACGAGCATTTCTCGAGAAATGCTCGTCATGCTCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207163
LMOD2 MISSION shRNA shRNA Plasmid DNA
leiomodin 2 (cardiac)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207163.1-1827s21c1
Sequence:CCGGAGAACTGTTCAGTGGTATTACCTCGAGGTAATACCACTGAACAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207163.1-1308s21c1
Sequence:CCGGCACCTAGCTCTTCACCTTATGCTCGAGCATAAGGTGAAGAGCTAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207163.1-978s21c1
Sequence:CCGGACGTCGAGTCCAACTTCATAACTCGAGTTATGAAGTTGGACTCGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207163.1-758s21c1
Sequence:CCGGGACGCTTTGGACAAGATTAAACTCGAGTTTAATCTTGTCCAAAGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207163.1-1179s21c1
Sequence:CCGGGAATGAGCATGACGAGCATTTCTCGAGAAATGCTCGTCATGCTCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207163
LMOD2 MISSION shRNA Lentiviral Transduction Particles
leiomodin 2 (cardiac)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207163.1-1827s21c1
Sequence:CCGGAGAACTGTTCAGTGGTATTACCTCGAGGTAATACCACTGAACAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207163.1-1308s21c1
Sequence:CCGGCACCTAGCTCTTCACCTTATGCTCGAGCATAAGGTGAAGAGCTAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207163.1-978s21c1
Sequence:CCGGACGTCGAGTCCAACTTCATAACTCGAGTTATGAAGTTGGACTCGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207163.1-758s21c1
Sequence:CCGGGACGCTTTGGACAAGATTAAACTCGAGTTTAATCTTGTCCAAAGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207163.1-1179s21c1
Sequence:CCGGGAATGAGCATGACGAGCATTTCTCGAGAAATGCTCGTCATGCTCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_132983
LMOD2 MISSION shRNA Bacterial Glycerol Stock
leiomodin 2 (cardiac)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132983.4-758s1c1
Sequence:CCGGACCCTGATACGACAGAAGTTACTCGAGTAACTTCTGTCGTATCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132983.4-930s1c1
Sequence:CCGGCGAGCACATTACCAGCGTAAACTCGAGTTTACGCTGGTAATGTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132983.4-703s1c1
Sequence:CCGGCCTTGTGGAAATCCCACTGTTCTCGAGAACAGTGGGATTTCCACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132983.4-759s1c1
Sequence:CCGGCCCTGATACGACAGAAGTTAACTCGAGTTAACTTCTGTCGTATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132983.4-1400s1c1
Sequence:CCGGGCAGTATAAGACAGCTACGGACTCGAGTCCGTAGCTGTCTTATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_132983
LMOD2 MISSION shRNA shRNA Plasmid DNA
leiomodin 2 (cardiac)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132983.4-758s1c1
Sequence:CCGGACCCTGATACGACAGAAGTTACTCGAGTAACTTCTGTCGTATCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132983.4-930s1c1
Sequence:CCGGCGAGCACATTACCAGCGTAAACTCGAGTTTACGCTGGTAATGTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132983.4-703s1c1
Sequence:CCGGCCTTGTGGAAATCCCACTGTTCTCGAGAACAGTGGGATTTCCACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132983.4-759s1c1
Sequence:CCGGCCCTGATACGACAGAAGTTAACTCGAGTTAACTTCTGTCGTATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132983.4-1400s1c1
Sequence:CCGGGCAGTATAAGACAGCTACGGACTCGAGTCCGTAGCTGTCTTATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_132983
LMOD2 MISSION shRNA Lentiviral Transduction Particles
leiomodin 2 (cardiac)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132983.4-758s1c1
Sequence:CCGGACCCTGATACGACAGAAGTTACTCGAGTAACTTCTGTCGTATCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132983.4-930s1c1
Sequence:CCGGCGAGCACATTACCAGCGTAAACTCGAGTTTACGCTGGTAATGTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132983.4-703s1c1
Sequence:CCGGCCTTGTGGAAATCCCACTGTTCTCGAGAACAGTGGGATTTCCACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132983.4-759s1c1
Sequence:CCGGCCCTGATACGACAGAAGTTAACTCGAGTTAACTTCTGTCGTATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132983.4-1400s1c1
Sequence:CCGGGCAGTATAAGACAGCTACGGACTCGAGTCCGTAGCTGTCTTATACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)