EMAIL THIS PAGE TO A FRIEND

LMOD3

leiomodin 3 (fetal)

54 Gene Product Result for
UniProtKB ID: Q0VAK6, B4DT85, Q0JTT2, Q5JPG6, Q8IUK4, Q96LS4
Gene ID:
Mouse(320502) leiomodin 3 (fetal)
Rat(500267) leiomodin 3 (fetal)
chicken(771594) leiomodin 3 (fetal)
cow(509978) leiomodin 3 (fetal)
Horse(100053299) leiomodin 3 (fetal)
domestic cat(101090679) leiomodin 3 (fetal)
dog(476558) leiomodin 3 (fetal)
domestic guinea pig(100732034) leiomodin 3 (fetal)
naked mole-rat(101717678) leiomodin 3 (fetal)
sheep(101116095) leiomodin 3 (fetal)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_149772 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_149772 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_149772 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198271 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198271 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198271 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039841 MISSION® esiRNA esiRNA human LMOD3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198271 Rosetta Predictions human pricing
XM_575617 Rosetta Predictions rat pricing
NM_001081157 Rosetta Predictions mouse pricing
XM_149772 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191266 predicted 1077
2 SASI_Hs02_00371820 predicted 1491
3 SASI_Hs01_00191268 predicted 1132
4 SASI_Hs02_00371821 predicted 1119
5 SASI_Hs01_00191270 predicted 1181
6 SASI_Hs02_00371822 predicted 1368
7 SASI_Hs02_00371823 predicted 1774
8 SASI_Hs02_00371824 predicted 1926
9 SASI_Hs01_00191271 predicted 1045
10 SASI_Hs01_00191273 predicted 1663
11 SASI_Hs01_00191267 predicted 1825
12 SASI_Hs01_00191269 predicted 334
13 SASI_Hs01_00191272 predicted 1079
14 SASI_Hs01_00191274 predicted 386
15 SASI_Hs01_00191275 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575617 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403933 predicted 1853
2 SASI_Rn02_00403934 predicted 1883
3 SASI_Rn02_00403935 predicted 1947
4 SASI_Rn02_00403936 predicted 1884
5 SASI_Rn02_00403937 predicted 1851
6 SASI_Rn02_00403938 predicted 1943
7 SASI_Rn02_00403939 predicted 1917
8 SASI_Rn02_00403940 predicted 1918
9 SASI_Rn02_00403941 predicted 1923
10 SASI_Rn02_00403942 predicted 1921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081157 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295741 predicted 1899
2 SASI_Mm02_00295742 predicted 1005
3 SASI_Mm02_00295743 predicted 1257
4 SASI_Mm02_00295744 predicted 1383
5 SASI_Mm02_00295745 predicted 1037
6 SASI_Mm02_00295746 predicted 1474
7 SASI_Mm02_00295747 predicted 1115
8 SASI_Mm02_00295748 predicted 1344
9 SASI_Mm02_00295749 predicted 1723
10 SASI_Mm02_00295750 predicted 1706
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_149772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276346 predicted 1905
2 SASI_Mm01_00276347 predicted 1788
3 SASI_Mm01_00276348 predicted 1841
4 SASI_Mm01_00276349 predicted 1845
5 SASI_Mm01_00276350 predicted 1796
6 SASI_Mm01_00276351 predicted 1801
7 SASI_Mm01_00276352 predicted 1796
8 SASI_Mm01_00276353 predicted 1725
9 SASI_Mm01_00276354 predicted 1882
10 SASI_Mm01_00276355 predicted 1943
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_149772
LMOD3 MISSION shRNA Bacterial Glycerol Stock
leiomodin 3 (fetal)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_149772.4-2066s1c1
Sequence:CCGGGTTCACAGACAACACGTTCTTCTCGAGAAGAACGTGTTGTCTGTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149772.4-372s1c1
Sequence:CCGGCCCACAGGAAACTTCAACCATCTCGAGATGGTTGAAGTTTCCTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149772.4-822s1c1
Sequence:CCGGGACACATCAGAGACCAAAGAACTCGAGTTCTTTGGTCTCTGATGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149772.4-1365s1c1
Sequence:CCGGCCCAGAATGGTGGTAACGAATCTCGAGATTCGTTACCACCATTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149772.4-1863s1c1
Sequence:CCGGGCCTACCTTAAACCTGTGCAACTCGAGTTGCACAGGTTTAAGGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_149772
LMOD3 MISSION shRNA shRNA Plasmid DNA
leiomodin 3 (fetal)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_149772.4-2066s1c1
Sequence:CCGGGTTCACAGACAACACGTTCTTCTCGAGAAGAACGTGTTGTCTGTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149772.4-372s1c1
Sequence:CCGGCCCACAGGAAACTTCAACCATCTCGAGATGGTTGAAGTTTCCTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149772.4-822s1c1
Sequence:CCGGGACACATCAGAGACCAAAGAACTCGAGTTCTTTGGTCTCTGATGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149772.4-1365s1c1
Sequence:CCGGCCCAGAATGGTGGTAACGAATCTCGAGATTCGTTACCACCATTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149772.4-1863s1c1
Sequence:CCGGGCCTACCTTAAACCTGTGCAACTCGAGTTGCACAGGTTTAAGGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_149772
LMOD3 MISSION shRNA Lentiviral Transduction Particles
leiomodin 3 (fetal)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_149772.4-2066s1c1
Sequence:CCGGGTTCACAGACAACACGTTCTTCTCGAGAAGAACGTGTTGTCTGTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149772.4-372s1c1
Sequence:CCGGCCCACAGGAAACTTCAACCATCTCGAGATGGTTGAAGTTTCCTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149772.4-822s1c1
Sequence:CCGGGACACATCAGAGACCAAAGAACTCGAGTTCTTTGGTCTCTGATGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149772.4-1365s1c1
Sequence:CCGGCCCAGAATGGTGGTAACGAATCTCGAGATTCGTTACCACCATTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149772.4-1863s1c1
Sequence:CCGGGCCTACCTTAAACCTGTGCAACTCGAGTTGCACAGGTTTAAGGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198271
LMOD3 MISSION shRNA Bacterial Glycerol Stock
leiomodin 3 (fetal)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198271.2-325s1c1
Sequence:CCGGCCCGTGGGAATGATTCAGAAACTCGAGTTTCTGAATCATTCCCACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198271.2-793s1c1
Sequence:CCGGGCCCAAGAACAAAGTGAGAAACTCGAGTTTCTCACTTTGTTCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198271.3-1152s21c1
Sequence:CCGGCTCAACATCGAGTCCAATTTCCTCGAGGAAATTGGACTCGATGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198271.3-1200s21c1
Sequence:CCGGATGAGGTGTCTCCAGTTTAATCTCGAGATTAAACTGGAGACACCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198271.3-2285s21c1
Sequence:CCGGTCCATCTCTTCTGCGGTAATTCTCGAGAATTACCGCAGAAGAGATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198271.3-2011s21c1
Sequence:CCGGTACCATCTGATAAGGGTATTTCTCGAGAAATACCCTTATCAGATGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198271.3-395s21c1
Sequence:CCGGGACAGGAAACTTCAATCATAACTCGAGTTATGATTGAAGTTTCCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198271
LMOD3 MISSION shRNA shRNA Plasmid DNA
leiomodin 3 (fetal)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198271.2-325s1c1
Sequence:CCGGCCCGTGGGAATGATTCAGAAACTCGAGTTTCTGAATCATTCCCACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198271.2-793s1c1
Sequence:CCGGGCCCAAGAACAAAGTGAGAAACTCGAGTTTCTCACTTTGTTCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198271.3-1152s21c1
Sequence:CCGGCTCAACATCGAGTCCAATTTCCTCGAGGAAATTGGACTCGATGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198271.3-1200s21c1
Sequence:CCGGATGAGGTGTCTCCAGTTTAATCTCGAGATTAAACTGGAGACACCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198271.3-2285s21c1
Sequence:CCGGTCCATCTCTTCTGCGGTAATTCTCGAGAATTACCGCAGAAGAGATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198271.3-2011s21c1
Sequence:CCGGTACCATCTGATAAGGGTATTTCTCGAGAAATACCCTTATCAGATGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198271.3-395s21c1
Sequence:CCGGGACAGGAAACTTCAATCATAACTCGAGTTATGATTGAAGTTTCCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198271
LMOD3 MISSION shRNA Lentiviral Transduction Particles
leiomodin 3 (fetal)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198271.2-325s1c1
Sequence:CCGGCCCGTGGGAATGATTCAGAAACTCGAGTTTCTGAATCATTCCCACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198271.2-793s1c1
Sequence:CCGGGCCCAAGAACAAAGTGAGAAACTCGAGTTTCTCACTTTGTTCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198271.3-1152s21c1
Sequence:CCGGCTCAACATCGAGTCCAATTTCCTCGAGGAAATTGGACTCGATGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198271.3-1200s21c1
Sequence:CCGGATGAGGTGTCTCCAGTTTAATCTCGAGATTAAACTGGAGACACCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198271.3-2285s21c1
Sequence:CCGGTCCATCTCTTCTGCGGTAATTCTCGAGAATTACCGCAGAAGAGATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198271.3-2011s21c1
Sequence:CCGGTACCATCTGATAAGGGTATTTCTCGAGAAATACCCTTATCAGATGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198271.3-395s21c1
Sequence:CCGGGACAGGAAACTTCAATCATAACTCGAGTTATGATTGAAGTTTCCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)