EMAIL THIS PAGE TO A FRIEND

LMTK2

lemur tyrosine kinase 2

116 Gene Product Result for
Synonyms: AATYK2 BREK KPI-2 KPI2 LMR2 cprk
UniProtKB ID: Q8IWU2, A4D272, Q75MG7, Q9UPS3
Gene ID:
Human(22853) Summary: The protein encoded by this gene belongs to the protein kinase superfamily and the protein tyrosine kinase family. It contains N-terminal transmembrane helices and a long C-terminal cytoplasmic tail with serine/threonine/tyrosine kinase activity. This protein interacts with several other proteins, such as Inhibitor-2 (Inh2), protein phosphatase-1 (PP1C), p35, and myosin VI. It phosporylates other proteins, and is itself also phosporylated when interacting with cyclin-dependent kinase 5 (cdk5)/p35 complex. This protein involves in nerve growth factor (NGF)-TrkA signalling, and also plays a critical role in endosomal membrane trafficking. Mouse studies suggested an essential role of this protein in spermatogenesis. [provided by RefSeq, Oct 2009]
Mouse(231876) lemur tyrosine kinase 2
Rat(304286) lemur tyrosine kinase 2
Zebrafish(449717) lemur tyrosine kinase 2
Horse(100629931) lemur tyrosine kinase 2
cow(512290) lemur tyrosine kinase 2
dog(608946) lemur tyrosine kinase 2
chicken(769200) lemur tyrosine kinase 2
domestic cat(101097774) lemur tyrosine kinase 2
sheep(101104881) lemur tyrosine kinase 2
Domestic Rabbit(100355751) lemur tyrosine kinase 2
domestic guinea pig(100715694) lemur tyrosine kinase 2
naked mole-rat(101715657) lemur tyrosine kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014916 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_132499 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_132499 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_132499 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001081109 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081109 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081109 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014916 Rosetta Predictions human pricing
XM_239606 Rosetta Predictions rat pricing
XR_008776 Rosetta Predictions rat pricing
NM_001081109 Rosetta Predictions mouse pricing
XM_132499 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084139 predicted 1930
2 SASI_Hs01_00084141 predicted 1714
3 SASI_Hs01_00084142 predicted 1968
4 SASI_Hs01_00084144 predicted 3125
5 SASI_Hs01_00084145 predicted 4377
6 SASI_Hs01_00084146 predicted 1154
7 SASI_Hs02_00346562 predicted 1320
8 SASI_Hs01_00084147 predicted 2666
9 SASI_Hs01_00084148 predicted 4683
10 SASI_Hs02_00346563 predicted 3753
11 SASI_Hs01_00084140 predicted 894
12 SASI_Hs01_00084143 predicted 1268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_239606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391524 predicted 1049
2 SASI_Rn02_00391525 predicted 680
3 SASI_Rn02_00391526 predicted 1335
4 SASI_Rn02_00391527 predicted 2161
5 SASI_Rn02_00391528 predicted 1022
6 SASI_Rn02_00391529 predicted 715
7 SASI_Rn02_00391530 predicted 1896
8 SASI_Rn02_00391531 predicted 1838
9 SASI_Rn02_00391532 predicted 596
10 SASI_Rn02_00391533 predicted 1257
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008776 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00417875 predicted 2951
2 SASI_Rn02_00417876 predicted 4455
3 SASI_Rn02_00417877 predicted 3411
4 SASI_Rn02_00417878 predicted 4026
5 SASI_Rn01_00144027 predicted 3918
6 SASI_Rn02_00417879 predicted 3970
7 SASI_Rn01_00144029 predicted 2603
8 SASI_Rn01_00144030 predicted 2836
9 SASI_Rn02_00417880 predicted 3042
10 SASI_Rn02_00417881 predicted 3739
11 SASI_Rn01_00144024 predicted 1054
12 SASI_Rn01_00144025 predicted 679
13 SASI_Rn01_00144026 predicted 2289
14 SASI_Rn01_00144028 predicted 1171
15 SASI_Rn01_00144031 predicted 2165
16 SASI_Rn01_00144032 predicted 1021
17 SASI_Rn01_00144033 predicted 4335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081109 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295271 predicted 727
2 SASI_Mm02_00295272 predicted 1017
3 SASI_Mm02_00295273 predicted 3933
4 SASI_Mm02_00295274 predicted 3065
5 SASI_Mm02_00295275 predicted 1079
6 SASI_Mm02_00295276 predicted 4460
7 SASI_Mm02_00295277 predicted 1204
8 SASI_Mm02_00295278 predicted 1751
9 SASI_Mm02_00295279 predicted 3741
10 SASI_Mm02_00295280 predicted 2105
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266916 predicted 733
2 SASI_Mm01_00266917 predicted 1029
3 SASI_Mm01_00266918 predicted 3936
4 SASI_Mm01_00266919 predicted 3072
5 SASI_Mm01_00266920 predicted 1091
6 SASI_Mm01_00266921 predicted 4467
7 SASI_Mm01_00266922 predicted 2736
8 SASI_Mm01_00266923 predicted 1212
9 SASI_Mm01_00266924 predicted 1765
10 SASI_Mm01_00266925 predicted 2113
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014916
VALIDATED
LMTK2 MISSION shRNA Bacterial Glycerol Stock
lemur tyrosine kinase 2
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.2-1426s1c1
Sequence:CCGGCCTACTCTGATAGATGGTATGCTCGAGCATACCATCTATCAGAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.x-4807s1c1
Sequence:CCGGCTGACATGAGATTGGGAGGAACTCGAGTTCCTCCCAATCTCATGTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014916.x-855s1c1
Sequence:CCGGCCTTACTACATTCTTCAGCATCTCGAGATGCTGAAGAATGTAGTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.x-2178s1c1
Sequence:CCGGGAGAGCCCTTTCAACAATATACTCGAGTATATTGTTGAAAGGGCTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.x-813s1c1
Sequence:CCGGGCCAACCCAAAGGAACAAGATCTCGAGATCTTGTTCCTTTGGGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.x-3504s1c1
Sequence:CCGGCCGGTCATTGTCATCTCAGATCTCGAGATCTGAGATGACAATGACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014916.2-1160s21c1
Sequence:CCGGCAGGTACAAGGAGGATTATATCTCGAGATATAATCCTCCTTGTACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014916.2-2267s1c1
Sequence:CCGGCGGAGTTCAAGCCGACTTTAACTCGAGTTAAAGTCGGCTTGAACTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014916.2-1798s1c1
Sequence:CCGGGCATCTTCTATCCGGTTGAAGCTCGAGCTTCAACCGGATAGAAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014916.2-5227s21c1
Sequence:CCGGGGTCACCAGTGAGCCATATTTCTCGAGAAATATGGCTCACTGGTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.2-2817s1c1
Sequence:CCGGCCCACGTGTTTAGATGTTATTCTCGAGAATAACATCTAAACACGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014916.2-504s1c1
Sequence:CCGGGACCCAGAAATAGACTTTAAGCTCGAGCTTAAAGTCTATTTCTGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014916.2-2178s21c1
Sequence:CCGGGAGAGCCCTTTCAACAATATACTCGAGTATATTGTTGAAAGGGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014916.2-2817s21c1
Sequence:CCGGCCCACGTGTTTAGATGTTATTCTCGAGAATAACATCTAAACACGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.2-5280s1c1
Sequence:CCGGGTAATTGCACTGTGGATAAATCTCGAGATTTATCCACAGTGCAATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014916.2-2266s21c1
Sequence:CCGGACGGAGTTCAAGCCGACTTTACTCGAGTAAAGTCGGCTTGAACTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014916
VALIDATED
LMTK2 MISSION shRNA shRNA Plasmid DNA
lemur tyrosine kinase 2
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.2-1426s1c1
Sequence:CCGGCCTACTCTGATAGATGGTATGCTCGAGCATACCATCTATCAGAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.x-4807s1c1
Sequence:CCGGCTGACATGAGATTGGGAGGAACTCGAGTTCCTCCCAATCTCATGTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014916.x-855s1c1
Sequence:CCGGCCTTACTACATTCTTCAGCATCTCGAGATGCTGAAGAATGTAGTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.x-2178s1c1
Sequence:CCGGGAGAGCCCTTTCAACAATATACTCGAGTATATTGTTGAAAGGGCTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.x-813s1c1
Sequence:CCGGGCCAACCCAAAGGAACAAGATCTCGAGATCTTGTTCCTTTGGGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.x-3504s1c1
Sequence:CCGGCCGGTCATTGTCATCTCAGATCTCGAGATCTGAGATGACAATGACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014916.2-1160s21c1
Sequence:CCGGCAGGTACAAGGAGGATTATATCTCGAGATATAATCCTCCTTGTACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014916.2-2267s1c1
Sequence:CCGGCGGAGTTCAAGCCGACTTTAACTCGAGTTAAAGTCGGCTTGAACTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014916.2-1798s1c1
Sequence:CCGGGCATCTTCTATCCGGTTGAAGCTCGAGCTTCAACCGGATAGAAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014916.2-5227s21c1
Sequence:CCGGGGTCACCAGTGAGCCATATTTCTCGAGAAATATGGCTCACTGGTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.2-2817s1c1
Sequence:CCGGCCCACGTGTTTAGATGTTATTCTCGAGAATAACATCTAAACACGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014916.2-504s1c1
Sequence:CCGGGACCCAGAAATAGACTTTAAGCTCGAGCTTAAAGTCTATTTCTGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014916.2-2178s21c1
Sequence:CCGGGAGAGCCCTTTCAACAATATACTCGAGTATATTGTTGAAAGGGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014916.2-2817s21c1
Sequence:CCGGCCCACGTGTTTAGATGTTATTCTCGAGAATAACATCTAAACACGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.2-5280s1c1
Sequence:CCGGGTAATTGCACTGTGGATAAATCTCGAGATTTATCCACAGTGCAATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014916.2-2266s21c1
Sequence:CCGGACGGAGTTCAAGCCGACTTTACTCGAGTAAAGTCGGCTTGAACTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014916
VALIDATED
LMTK2 MISSION shRNA Lentiviral Transduction Particles
lemur tyrosine kinase 2
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.2-1426s1c1
Sequence:CCGGCCTACTCTGATAGATGGTATGCTCGAGCATACCATCTATCAGAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.x-4807s1c1
Sequence:CCGGCTGACATGAGATTGGGAGGAACTCGAGTTCCTCCCAATCTCATGTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014916.x-855s1c1
Sequence:CCGGCCTTACTACATTCTTCAGCATCTCGAGATGCTGAAGAATGTAGTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.x-2178s1c1
Sequence:CCGGGAGAGCCCTTTCAACAATATACTCGAGTATATTGTTGAAAGGGCTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.x-813s1c1
Sequence:CCGGGCCAACCCAAAGGAACAAGATCTCGAGATCTTGTTCCTTTGGGTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.x-3504s1c1
Sequence:CCGGCCGGTCATTGTCATCTCAGATCTCGAGATCTGAGATGACAATGACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014916.2-1160s21c1
Sequence:CCGGCAGGTACAAGGAGGATTATATCTCGAGATATAATCCTCCTTGTACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014916.2-2267s1c1
Sequence:CCGGCGGAGTTCAAGCCGACTTTAACTCGAGTTAAAGTCGGCTTGAACTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014916.2-1798s1c1
Sequence:CCGGGCATCTTCTATCCGGTTGAAGCTCGAGCTTCAACCGGATAGAAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014916.2-5227s21c1
Sequence:CCGGGGTCACCAGTGAGCCATATTTCTCGAGAAATATGGCTCACTGGTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.2-2817s1c1
Sequence:CCGGCCCACGTGTTTAGATGTTATTCTCGAGAATAACATCTAAACACGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014916.2-504s1c1
Sequence:CCGGGACCCAGAAATAGACTTTAAGCTCGAGCTTAAAGTCTATTTCTGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014916.2-2178s21c1
Sequence:CCGGGAGAGCCCTTTCAACAATATACTCGAGTATATTGTTGAAAGGGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014916.2-2817s21c1
Sequence:CCGGCCCACGTGTTTAGATGTTATTCTCGAGAATAACATCTAAACACGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014916.2-5280s1c1
Sequence:CCGGGTAATTGCACTGTGGATAAATCTCGAGATTTATCCACAGTGCAATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014916.2-2266s21c1
Sequence:CCGGACGGAGTTCAAGCCGACTTTACTCGAGTAAAGTCGGCTTGAACTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_132499
VALIDATED
LMTK2 MISSION shRNA Bacterial Glycerol Stock
lemur tyrosine kinase 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000023335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132499.4-2681s1c1
Sequence:CCGGCCCATCCTTGTGAATGATATTCTCGAGAATATCATTCACAAGGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132499.4-1558s1c1
Sequence:CCGGCCTGTCTTACTCCAGCATGTTCTCGAGAACATGCTGGAGTAAGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132499.4-2242s1c1
Sequence:CCGGCGACCTTCAAACAGAACTCAACTCGAGTTGAGTTCTGTTTGAAGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132499.4-3932s1c1
Sequence:CCGGCCCATCATTGTCAGTAACGATCTCGAGATCGTTACTGACAATGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_132499
VALIDATED
LMTK2 MISSION shRNA shRNA Plasmid DNA
lemur tyrosine kinase 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000023335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132499.4-2681s1c1
Sequence:CCGGCCCATCCTTGTGAATGATATTCTCGAGAATATCATTCACAAGGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132499.4-1558s1c1
Sequence:CCGGCCTGTCTTACTCCAGCATGTTCTCGAGAACATGCTGGAGTAAGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132499.4-2242s1c1
Sequence:CCGGCGACCTTCAAACAGAACTCAACTCGAGTTGAGTTCTGTTTGAAGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132499.4-3932s1c1
Sequence:CCGGCCCATCATTGTCAGTAACGATCTCGAGATCGTTACTGACAATGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_132499
VALIDATED
LMTK2 MISSION shRNA Lentiviral Transduction Particles
lemur tyrosine kinase 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000023335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132499.4-2681s1c1
Sequence:CCGGCCCATCCTTGTGAATGATATTCTCGAGAATATCATTCACAAGGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132499.4-1558s1c1
Sequence:CCGGCCTGTCTTACTCCAGCATGTTCTCGAGAACATGCTGGAGTAAGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132499.4-2242s1c1
Sequence:CCGGCGACCTTCAAACAGAACTCAACTCGAGTTGAGTTCTGTTTGAAGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132499.4-3932s1c1
Sequence:CCGGCCCATCATTGTCAGTAACGATCTCGAGATCGTTACTGACAATGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081109
VALIDATED
LMTK2 MISSION shRNA Bacterial Glycerol Stock
lemur tyrosine kinase 2
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000367993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081109.1-727s21c1
Sequence:CCGGAGTCATAGTGAAGGAGTTAAACTCGAGTTTAACTCCTTCACTATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081109.1-5092s21c1
Sequence:CCGGTATTGTACAGCATCGTAAATTCTCGAGAATTTACGATGCTGTACAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081109.1-4220s21c1
Sequence:CCGGTTCGATGATGTCACCGTTTATCTCGAGATAAACGGTGACATCATCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081109
VALIDATED
LMTK2 MISSION shRNA shRNA Plasmid DNA
lemur tyrosine kinase 2
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000367993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081109.1-727s21c1
Sequence:CCGGAGTCATAGTGAAGGAGTTAAACTCGAGTTTAACTCCTTCACTATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081109.1-5092s21c1
Sequence:CCGGTATTGTACAGCATCGTAAATTCTCGAGAATTTACGATGCTGTACAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081109.1-4220s21c1
Sequence:CCGGTTCGATGATGTCACCGTTTATCTCGAGATAAACGGTGACATCATCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081109
VALIDATED
LMTK2 MISSION shRNA Lentiviral Transduction Particles
lemur tyrosine kinase 2
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000367993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081109.1-727s21c1
Sequence:CCGGAGTCATAGTGAAGGAGTTAAACTCGAGTTTAACTCCTTCACTATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367997    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081109.1-5092s21c1
Sequence:CCGGTATTGTACAGCATCGTAAATTCTCGAGAATTTACGATGCTGTACAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081109.1-4220s21c1
Sequence:CCGGTTCGATGATGTCACCGTTTATCTCGAGATAAACGGTGACATCATCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)