EMAIL THIS PAGE TO A FRIEND

LNX1

ligand of numb-protein X 1, E3 ubiquitin protein ligase

83 Gene Product Result for
Synonyms: LNX MPDZ PDZRN2
UniProtKB ID: Q8TBB1, Q4W5K7, Q8N4C2, Q96MJ7, Q9BY20
Gene ID:
Human(84708) Summary: This gene encodes a membrane-bound protein that is involved in signal transduction and protein interactions. The encoded product is an E3 ubiquitin-protein ligase, which mediates ubiquitination and subsequent proteasomal degradation of proteins containing phosphotyrosine binding (PTB) domains. This protein may play an important role in tumorogenesis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A pseudogene, which is located on chromosome 17, has been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(16924) ligand of numb-protein X 1
Rat(360926) ligand of numb-protein X 1, E3 ubiquitin protein ligase
Zebrafish(561226) ligand of numb-protein X 1
chicken(422752) ligand of numb-protein X 1, E3 ubiquitin protein ligase
dog(475143) ligand of numb-protein X 1, E3 ubiquitin protein ligase
cow(540694) ligand of numb-protein X 1
Horse(100054101) ligand of numb-protein X 1, E3 ubiquitin protein ligase
domestic cat(101091782) ligand of numb-protein X 1, E3 ubiquitin protein ligase
domestic guinea pig(100725036) ligand of numb-protein X 1, E3 ubiquitin protein ligase
naked mole-rat(101699931) ligand of numb-protein X 1, E3 ubiquitin protein ligase
sheep(101105501) ligand of numb-protein X 1, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010727 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010727 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010727 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032622 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134861 MISSION® esiRNA esiRNA human LNX1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126328 Rosetta Predictions human pricing
NM_032622 Rosetta Predictions human pricing
NM_001108358 Rosetta Predictions rat pricing
NM_010727 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328427 predicted 1844
2 SASI_Hs02_00328428 predicted 1759
3 SASI_Hs02_00328429 predicted 1545
4 SASI_Hs02_00328430 predicted 1594
5 SASI_Hs02_00328431 predicted 1096
6 SASI_Hs02_00328432 predicted 1840
7 SASI_Hs02_00328433 predicted 2389
8 SASI_Hs02_00328434 predicted 880
9 SASI_Hs02_00328435 predicted 951
10 SASI_Hs02_00328436 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150308 predicted 1603
2 SASI_Hs01_00150309 predicted 1520
3 SASI_Hs01_00150310 predicted 1304
4 SASI_Hs01_00150311 predicted 1351
5 SASI_Hs01_00150312 predicted 854
6 SASI_Hs01_00150313 predicted 1593
7 SASI_Hs01_00150314 predicted 2155
8 SASI_Hs01_00150315 predicted 645
9 SASI_Hs02_00360173 predicted 713
10 SASI_Hs02_00360174 predicted 694
11 SASI_Hs01_00150316 predicted 335
12 SASI_Hs01_00150317 predicted 1445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237879 predicted 821
2 SASI_Rn02_00237880 predicted 1769
3 SASI_Rn02_00237881 predicted 1160
4 SASI_Rn02_00237882 predicted 466
5 SASI_Rn02_00237883 predicted 1045
6 SASI_Rn02_00237884 predicted 1027
7 SASI_Rn02_00237885 predicted 593
8 SASI_Rn02_00237886 predicted 977
9 SASI_Rn02_00237887 predicted 2066
10 SASI_Rn02_00237888 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010727 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032643 predicted 2107
2 SASI_Mm01_00032644 predicted 1977
3 SASI_Mm01_00032645 predicted 830
4 SASI_Mm01_00032646 predicted 564
5 SASI_Mm01_00032647 predicted 1558
6 SASI_Mm01_00032648 predicted 1277
7 SASI_Mm01_00032649 predicted 2058
8 SASI_Mm02_00319223 predicted 2205
9 SASI_Mm01_00032650 predicted 1801
10 SASI_Mm01_00032651 predicted 1287
11 SASI_Mm01_00032652 predicted 265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010727
LNX1 MISSION shRNA Bacterial Glycerol Stock
ligand of numb-protein X 1, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010727.2-2401s1c1
Sequence:CCGGCCATACTGTCATTTACCTATTCTCGAGAATAGGTAAATGACAGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010727.2-592s1c1
Sequence:CCGGCCGGTCTTTCAAGAAGATCAACTCGAGTTGATCTTCTTGAAAGACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010727.2-718s1c1
Sequence:CCGGCCCAAGGTTGTTTCACCTGATCTCGAGATCAGGTGAAACAACCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010727.2-719s1c1
Sequence:CCGGCCAAGGTTGTTTCACCTGATTCTCGAGAATCAGGTGAAACAACCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010727.2-2005s1c1
Sequence:CCGGCGGTAGAAGTACATCGGGTATCTCGAGATACCCGATGTACTTCTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010727
LNX1 MISSION shRNA shRNA Plasmid DNA
ligand of numb-protein X 1, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010727.2-2401s1c1
Sequence:CCGGCCATACTGTCATTTACCTATTCTCGAGAATAGGTAAATGACAGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010727.2-592s1c1
Sequence:CCGGCCGGTCTTTCAAGAAGATCAACTCGAGTTGATCTTCTTGAAAGACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010727.2-718s1c1
Sequence:CCGGCCCAAGGTTGTTTCACCTGATCTCGAGATCAGGTGAAACAACCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010727.2-719s1c1
Sequence:CCGGCCAAGGTTGTTTCACCTGATTCTCGAGAATCAGGTGAAACAACCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010727.2-2005s1c1
Sequence:CCGGCGGTAGAAGTACATCGGGTATCTCGAGATACCCGATGTACTTCTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010727
LNX1 MISSION shRNA Lentiviral Transduction Particles
ligand of numb-protein X 1, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010727.2-2401s1c1
Sequence:CCGGCCATACTGTCATTTACCTATTCTCGAGAATAGGTAAATGACAGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010727.2-592s1c1
Sequence:CCGGCCGGTCTTTCAAGAAGATCAACTCGAGTTGATCTTCTTGAAAGACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010727.2-718s1c1
Sequence:CCGGCCCAAGGTTGTTTCACCTGATCTCGAGATCAGGTGAAACAACCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010727.2-719s1c1
Sequence:CCGGCCAAGGTTGTTTCACCTGATTCTCGAGAATCAGGTGAAACAACCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010727.2-2005s1c1
Sequence:CCGGCGGTAGAAGTACATCGGGTATCTCGAGATACCCGATGTACTTCTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032622
LNX1 MISSION shRNA Bacterial Glycerol Stock
ligand of numb-protein X 1, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032622.1-2950s1c1
Sequence:CCGGGCCTCCTAGAAACTACACTATCTCGAGATAGTGTAGTTTCTAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032622.1-904s1c1
Sequence:CCGGGCCAGGAGACATCATTCTAAACTCGAGTTTAGAATGATGTCTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032622.1-576s1c1
Sequence:CCGGCCTTTGAGAGATCCACTATTACTCGAGTAATAGTGGATCTCTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032622.1-1838s1c1
Sequence:CCGGCGGTGCTTGTATAACTGTAAACTCGAGTTTACAGTTATACAAGCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032622.1-588s1c1
Sequence:CCGGCCACTATTAGAAGCAGATCATCTCGAGATGATCTGCTTCTAATAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032622.2-1314s21c1
Sequence:CCGGATGGACATGATCTTCGATATGCTCGAGCATATCGAAGATCATGTCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032622.2-1761s21c1
Sequence:CCGGCATCCTCGATAGTACTCAAAGCTCGAGCTTTGAGTACTATCGAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032622.2-1524s21c1
Sequence:CCGGGTCATGAGAAGGTGGTAAATACTCGAGTATTTACCACCTTCTCATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032622.2-904s21c1
Sequence:CCGGCCCACTGGTCCATATCATTATCTCGAGATAATGATATGGACCAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032622
LNX1 MISSION shRNA shRNA Plasmid DNA
ligand of numb-protein X 1, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032622.1-2950s1c1
Sequence:CCGGGCCTCCTAGAAACTACACTATCTCGAGATAGTGTAGTTTCTAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032622.1-904s1c1
Sequence:CCGGGCCAGGAGACATCATTCTAAACTCGAGTTTAGAATGATGTCTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032622.1-576s1c1
Sequence:CCGGCCTTTGAGAGATCCACTATTACTCGAGTAATAGTGGATCTCTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032622.1-1838s1c1
Sequence:CCGGCGGTGCTTGTATAACTGTAAACTCGAGTTTACAGTTATACAAGCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032622.1-588s1c1
Sequence:CCGGCCACTATTAGAAGCAGATCATCTCGAGATGATCTGCTTCTAATAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032622.2-1314s21c1
Sequence:CCGGATGGACATGATCTTCGATATGCTCGAGCATATCGAAGATCATGTCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032622.2-1761s21c1
Sequence:CCGGCATCCTCGATAGTACTCAAAGCTCGAGCTTTGAGTACTATCGAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032622.2-1524s21c1
Sequence:CCGGGTCATGAGAAGGTGGTAAATACTCGAGTATTTACCACCTTCTCATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032622.2-904s21c1
Sequence:CCGGCCCACTGGTCCATATCATTATCTCGAGATAATGATATGGACCAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032622
LNX1 MISSION shRNA Lentiviral Transduction Particles
ligand of numb-protein X 1, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032622.1-2950s1c1
Sequence:CCGGGCCTCCTAGAAACTACACTATCTCGAGATAGTGTAGTTTCTAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032622.1-904s1c1
Sequence:CCGGGCCAGGAGACATCATTCTAAACTCGAGTTTAGAATGATGTCTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032622.1-576s1c1
Sequence:CCGGCCTTTGAGAGATCCACTATTACTCGAGTAATAGTGGATCTCTCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032622.1-1838s1c1
Sequence:CCGGCGGTGCTTGTATAACTGTAAACTCGAGTTTACAGTTATACAAGCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032622.1-588s1c1
Sequence:CCGGCCACTATTAGAAGCAGATCATCTCGAGATGATCTGCTTCTAATAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032622.2-1314s21c1
Sequence:CCGGATGGACATGATCTTCGATATGCTCGAGCATATCGAAGATCATGTCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032622.2-1761s21c1
Sequence:CCGGCATCCTCGATAGTACTCAAAGCTCGAGCTTTGAGTACTATCGAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032622.2-1524s21c1
Sequence:CCGGGTCATGAGAAGGTGGTAAATACTCGAGTATTTACCACCTTCTCATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032622.2-904s21c1
Sequence:CCGGCCCACTGGTCCATATCATTATCTCGAGATAATGATATGGACCAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)