EMAIL THIS PAGE TO A FRIEND

LNX2

ligand of numb-protein X 2

98 Gene Product Result for
Synonyms: PDZRN1
UniProtKB ID: Q8N448, Q5W0P0, Q6ZMH2, Q96SH4
Gene ID:
Mouse(140887) ligand of numb-protein X 2
Rat(360761) ligand of numb-protein X 2
chicken(418928) ligand of numb-protein X 2
cow(526424) ligand of numb-protein X 2
Horse(100061190) ligand of numb-protein X 2
domestic cat(101087544) ligand of numb-protein X 2
dog(486031) ligand of numb-protein X 2
sheep(101114788) ligand of numb-protein X 2
Domestic Rabbit(100339856) ligand of numb-protein X 2
domestic guinea pig(100719913) ligand of numb-protein X 2
naked mole-rat(101716517) ligand of numb-protein X 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153371 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080795 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080795 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080795 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029101 MISSION® esiRNA esiRNA human LNX2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153371 Rosetta Predictions human pricing
NM_001108329 Rosetta Predictions rat pricing
NM_080795 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367251 predicted 1235
2 SASI_Hs01_00162182 predicted 995
3 SASI_Hs02_00367252 predicted 1468
4 SASI_Hs02_00367253 predicted 1360
5 SASI_Hs01_00162183 predicted 708
6 SASI_Hs02_00367254 predicted 1177
7 SASI_Hs01_00162187 predicted 961
8 SASI_Hs01_00162188 predicted 1057
9 SASI_Hs01_00162189 predicted 2296
10 SASI_Hs02_00367255 predicted 337
11 SASI_Hs01_00162180 predicted 1714
12 SASI_Hs01_00162181 predicted 2078
13 SASI_Hs01_00162184 predicted 901
14 SASI_Hs01_00162185 predicted 1944
15 SASI_Hs01_00162186 predicted 1510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237589 predicted 650
2 SASI_Rn02_00237590 predicted 914
3 SASI_Rn02_00237591 predicted 903
4 SASI_Rn02_00237592 predicted 2053
5 SASI_Rn02_00237593 predicted 206
6 SASI_Rn02_00237594 predicted 1977
7 SASI_Rn02_00237595 predicted 1969
8 SASI_Rn02_00237596 predicted 678
9 SASI_Rn02_00237597 predicted 1747
10 SASI_Rn02_00237598 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117431 predicted 2071
2 SASI_Mm02_00338212 predicted 1771
3 SASI_Mm01_00117434 predicted 1256
4 SASI_Mm01_00117435 predicted 891
5 SASI_Mm01_00117436 predicted 931
6 SASI_Mm02_00338213 predicted 1984
7 SASI_Mm01_00117439 predicted 855
8 SASI_Mm02_00338214 predicted 2003
9 SASI_Mm02_00338215 predicted 972
10 SASI_Mm02_00338216 predicted 2338
11 SASI_Mm01_00117432 predicted 877
12 SASI_Mm01_00117433 predicted 1730
13 SASI_Mm01_00117437 predicted 2074
14 SASI_Mm01_00117438 predicted 444
15 SASI_Mm01_00117440 predicted 2105
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153371
VALIDATED
LNX2 MISSION shRNA Bacterial Glycerol Stock
ligand of numb-protein X 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153371.3-2254s21c1
Sequence:CCGGGACATGATTGTGGCCGTAAATCTCGAGATTTACGGCCACAATCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153371.3-1184s21c1
Sequence:CCGGGCAATGTGTCCCATAACTATGCTCGAGCATAGTTATGGGACACATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153371.3-2340s21c1
Sequence:CCGGAGTCACTCTGACCGTTATTTGCTCGAGCAAATAACGGTCAGAGTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153371.3-1636s21c1
Sequence:CCGGCACACACCACCACCGTATTATCTCGAGATAATACGGTGGTGGTGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153371.3-1282s21c1
Sequence:CCGGCACAACCATTCTGATAGTAACCTCGAGGTTACTATCAGAATGGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153371.3-1088s21c1
Sequence:CCGGTTGTCATCCAGGAGGTCTATCCTCGAGGATAGACCTCCTGGATGACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153371.3-2758s21c1
Sequence:CCGGGATGTCAGCAAAGCCAGTAACCTCGAGGTTACTGGCTTTGCTGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_153371.2-1707s1c1
Sequence:CCGGCGGCATTGATTTGACCAATTTCTCGAGAAATTGGTCAAATCAATGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153371.2-2414s1c1
Sequence:CCGGCCACTAACCTTTGTGAGTTTACTCGAGTAAACTCACAAAGGTTAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_153371.2-1055s1c1
Sequence:CCGGCCTGCAACACACTGCATCTTACTCGAGTAAGATGCAGTGTGTTGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153371.2-445s1c1
Sequence:CCGGGTTCATAAACTCCTAGACAAACTCGAGTTTGTCTAGGAGTTTATGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_153371.2-893s1c1
Sequence:CCGGGCAACGAAACACCTTTGATTACTCGAGTAATCAAAGGTGTTTCGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153371
VALIDATED
LNX2 MISSION shRNA shRNA Plasmid DNA
ligand of numb-protein X 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153371.3-2254s21c1
Sequence:CCGGGACATGATTGTGGCCGTAAATCTCGAGATTTACGGCCACAATCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153371.3-1184s21c1
Sequence:CCGGGCAATGTGTCCCATAACTATGCTCGAGCATAGTTATGGGACACATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153371.3-2340s21c1
Sequence:CCGGAGTCACTCTGACCGTTATTTGCTCGAGCAAATAACGGTCAGAGTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153371.3-1636s21c1
Sequence:CCGGCACACACCACCACCGTATTATCTCGAGATAATACGGTGGTGGTGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153371.3-1282s21c1
Sequence:CCGGCACAACCATTCTGATAGTAACCTCGAGGTTACTATCAGAATGGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153371.3-1088s21c1
Sequence:CCGGTTGTCATCCAGGAGGTCTATCCTCGAGGATAGACCTCCTGGATGACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153371.3-2758s21c1
Sequence:CCGGGATGTCAGCAAAGCCAGTAACCTCGAGGTTACTGGCTTTGCTGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_153371.2-1707s1c1
Sequence:CCGGCGGCATTGATTTGACCAATTTCTCGAGAAATTGGTCAAATCAATGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153371.2-2414s1c1
Sequence:CCGGCCACTAACCTTTGTGAGTTTACTCGAGTAAACTCACAAAGGTTAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_153371.2-1055s1c1
Sequence:CCGGCCTGCAACACACTGCATCTTACTCGAGTAAGATGCAGTGTGTTGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153371.2-445s1c1
Sequence:CCGGGTTCATAAACTCCTAGACAAACTCGAGTTTGTCTAGGAGTTTATGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_153371.2-893s1c1
Sequence:CCGGGCAACGAAACACCTTTGATTACTCGAGTAATCAAAGGTGTTTCGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153371
VALIDATED
LNX2 MISSION shRNA Lentiviral Transduction Particles
ligand of numb-protein X 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153371.3-2254s21c1
Sequence:CCGGGACATGATTGTGGCCGTAAATCTCGAGATTTACGGCCACAATCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153371.3-1184s21c1
Sequence:CCGGGCAATGTGTCCCATAACTATGCTCGAGCATAGTTATGGGACACATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153371.3-2340s21c1
Sequence:CCGGAGTCACTCTGACCGTTATTTGCTCGAGCAAATAACGGTCAGAGTGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153371.3-1636s21c1
Sequence:CCGGCACACACCACCACCGTATTATCTCGAGATAATACGGTGGTGGTGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153371.3-1282s21c1
Sequence:CCGGCACAACCATTCTGATAGTAACCTCGAGGTTACTATCAGAATGGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153371.3-1088s21c1
Sequence:CCGGTTGTCATCCAGGAGGTCTATCCTCGAGGATAGACCTCCTGGATGACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153371.3-2758s21c1
Sequence:CCGGGATGTCAGCAAAGCCAGTAACCTCGAGGTTACTGGCTTTGCTGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_153371.2-1707s1c1
Sequence:CCGGCGGCATTGATTTGACCAATTTCTCGAGAAATTGGTCAAATCAATGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153371.2-2414s1c1
Sequence:CCGGCCACTAACCTTTGTGAGTTTACTCGAGTAAACTCACAAAGGTTAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_153371.2-1055s1c1
Sequence:CCGGCCTGCAACACACTGCATCTTACTCGAGTAAGATGCAGTGTGTTGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153371.2-445s1c1
Sequence:CCGGGTTCATAAACTCCTAGACAAACTCGAGTTTGTCTAGGAGTTTATGAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_153371.2-893s1c1
Sequence:CCGGGCAACGAAACACCTTTGATTACTCGAGTAATCAAAGGTGTTTCGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080795
VALIDATED
LNX2 MISSION shRNA Bacterial Glycerol Stock
ligand of numb-protein X 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080795.4-1252s21c1
Sequence:CCGGACAGAGCAGCTCGGCATTAAACTCGAGTTTAATGCCGAGCTGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080795.4-2728s21c1
Sequence:CCGGTCCTCAACTGAAGACATAAACCTCGAGGTTTATGTCTTCAGTTGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080795.4-976s21c1
Sequence:CCGGCCACTGATCAACATCGTCATTCTCGAGAATGACGATGTTGATCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080795.4-353s21c1
Sequence:CCGGACGACCTCGTGTGCCACATTTCTCGAGAAATGTGGCACACGAGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080795.4-1411s21c1
Sequence:CCGGGAGCTCGCTGCCCAGATTATTCTCGAGAATAATCTGGGCAGCGAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080795.3-443s1c1
Sequence:CCGGGCTTCATTTCAAGCTGTGTAACTCGAGTTACACAGCTTGAAATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080795.3-2076s1c1
Sequence:CCGGGCTTACTATGACGGAAGATTACTCGAGTAATCTTCCGTCATAGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080795.3-933s1c1
Sequence:CCGGCCACTGATCAACATCGTCATTCTCGAGAATGACGATGTTGATCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080795.3-3299s1c1
Sequence:CCGGCGGCATAATGAGAAAGTAAATCTCGAGATTTACTTTCTCATTATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080795.3-1401s1c1
Sequence:CCGGGAGAGGGTGAACTTAACAATTCTCGAGAATTGTTAAGTTCACCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080795
VALIDATED
LNX2 MISSION shRNA shRNA Plasmid DNA
ligand of numb-protein X 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080795.4-1252s21c1
Sequence:CCGGACAGAGCAGCTCGGCATTAAACTCGAGTTTAATGCCGAGCTGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080795.4-2728s21c1
Sequence:CCGGTCCTCAACTGAAGACATAAACCTCGAGGTTTATGTCTTCAGTTGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080795.4-976s21c1
Sequence:CCGGCCACTGATCAACATCGTCATTCTCGAGAATGACGATGTTGATCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080795.4-353s21c1
Sequence:CCGGACGACCTCGTGTGCCACATTTCTCGAGAAATGTGGCACACGAGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080795.4-1411s21c1
Sequence:CCGGGAGCTCGCTGCCCAGATTATTCTCGAGAATAATCTGGGCAGCGAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080795.3-443s1c1
Sequence:CCGGGCTTCATTTCAAGCTGTGTAACTCGAGTTACACAGCTTGAAATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080795.3-2076s1c1
Sequence:CCGGGCTTACTATGACGGAAGATTACTCGAGTAATCTTCCGTCATAGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080795.3-933s1c1
Sequence:CCGGCCACTGATCAACATCGTCATTCTCGAGAATGACGATGTTGATCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080795.3-3299s1c1
Sequence:CCGGCGGCATAATGAGAAAGTAAATCTCGAGATTTACTTTCTCATTATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080795.3-1401s1c1
Sequence:CCGGGAGAGGGTGAACTTAACAATTCTCGAGAATTGTTAAGTTCACCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080795
VALIDATED
LNX2 MISSION shRNA Lentiviral Transduction Particles
ligand of numb-protein X 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080795.4-1252s21c1
Sequence:CCGGACAGAGCAGCTCGGCATTAAACTCGAGTTTAATGCCGAGCTGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080795.4-2728s21c1
Sequence:CCGGTCCTCAACTGAAGACATAAACCTCGAGGTTTATGTCTTCAGTTGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080795.4-976s21c1
Sequence:CCGGCCACTGATCAACATCGTCATTCTCGAGAATGACGATGTTGATCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_080795.4-353s21c1
Sequence:CCGGACGACCTCGTGTGCCACATTTCTCGAGAAATGTGGCACACGAGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080795.4-1411s21c1
Sequence:CCGGGAGCTCGCTGCCCAGATTATTCTCGAGAATAATCTGGGCAGCGAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080795.3-443s1c1
Sequence:CCGGGCTTCATTTCAAGCTGTGTAACTCGAGTTACACAGCTTGAAATGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080795.3-2076s1c1
Sequence:CCGGGCTTACTATGACGGAAGATTACTCGAGTAATCTTCCGTCATAGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080795.3-933s1c1
Sequence:CCGGCCACTGATCAACATCGTCATTCTCGAGAATGACGATGTTGATCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_080795.3-3299s1c1
Sequence:CCGGCGGCATAATGAGAAAGTAAATCTCGAGATTTACTTTCTCATTATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080795.3-1401s1c1
Sequence:CCGGGAGAGGGTGAACTTAACAATTCTCGAGAATTGTTAAGTTCACCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)