EMAIL THIS PAGE TO A FRIEND

LOC100130932

4 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001146693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001146693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001146693 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001725268 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00466544 predicted 989
2 SASI_Hs02_00466545 predicted 1010
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001146693
LOC100130932 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146693.1-705s21c1
Sequence:CCGGCTCTCTCCATAGGGCCTGTTTCTCGAGAAACAGGCCCTATGGAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146693.1-514s21c1
Sequence:CCGGCAGACATGTCCAAGGAATATTCTCGAGAATATTCCTTGGACATGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146693.1-617s21c1
Sequence:CCGGATGGTGGAAATACGAGGAAATCTCGAGATTTCCTCGTATTTCCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146693.1-655s21c1
Sequence:CCGGAGCCTTGGAATGAGTATAAATCTCGAGATTTATACTCATTCCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146693.1-556s21c1
Sequence:CCGGGAACCTTGTGATAGATGAATGCTCGAGCATTCATCTATCACAAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001146693
LOC100130932 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146693.1-705s21c1
Sequence:CCGGCTCTCTCCATAGGGCCTGTTTCTCGAGAAACAGGCCCTATGGAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146693.1-514s21c1
Sequence:CCGGCAGACATGTCCAAGGAATATTCTCGAGAATATTCCTTGGACATGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146693.1-617s21c1
Sequence:CCGGATGGTGGAAATACGAGGAAATCTCGAGATTTCCTCGTATTTCCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146693.1-655s21c1
Sequence:CCGGAGCCTTGGAATGAGTATAAATCTCGAGATTTATACTCATTCCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146693.1-556s21c1
Sequence:CCGGGAACCTTGTGATAGATGAATGCTCGAGCATTCATCTATCACAAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001146693
LOC100130932 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146693.1-705s21c1
Sequence:CCGGCTCTCTCCATAGGGCCTGTTTCTCGAGAAACAGGCCCTATGGAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146693.1-514s21c1
Sequence:CCGGCAGACATGTCCAAGGAATATTCTCGAGAATATTCCTTGGACATGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146693.1-617s21c1
Sequence:CCGGATGGTGGAAATACGAGGAAATCTCGAGATTTCCTCGTATTTCCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146693.1-655s21c1
Sequence:CCGGAGCCTTGGAATGAGTATAAATCTCGAGATTTATACTCATTCCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146693.1-556s21c1
Sequence:CCGGGAACCTTGTGATAGATGAATGCTCGAGCATTCATCTATCACAAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)