EMAIL THIS PAGE TO A FRIEND

LOC100132832

7 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001129851 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001129851 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001129851 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001722503 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00449573 predicted 1500
2 SASI_Hs02_00449574 predicted 1257
3 SASI_Hs02_00449575 predicted 1237
4 SASI_Hs02_00449576 predicted 1237
5 SASI_Hs02_00449577 predicted 1263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001129851
LOC100132832 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129851.1-1067s21c1
Sequence:CCGGTTCTAGATGATCTGCACAAATCTCGAGATTTGTGCAGATCATCTAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129851.1-1019s21c1
Sequence:CCGGGGACAACGTGATCACTGTATTCTCGAGAATACAGTGATCACGTTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129851.1-844s21c1
Sequence:CCGGCTGTGCGCCATAAGGAATTTCCTCGAGGAAATTCCTTATGGCGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129851.1-1878s21c1
Sequence:CCGGCCCACATCGCCTGGCTAATTTCTCGAGAAATTAGCCAGGCGATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129851.1-812s21c1
Sequence:CCGGAGTCAGCGTGAAGCAGTTATTCTCGAGAATAACTGCTTCACGCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001129851
LOC100132832 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129851.1-1067s21c1
Sequence:CCGGTTCTAGATGATCTGCACAAATCTCGAGATTTGTGCAGATCATCTAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129851.1-1019s21c1
Sequence:CCGGGGACAACGTGATCACTGTATTCTCGAGAATACAGTGATCACGTTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129851.1-844s21c1
Sequence:CCGGCTGTGCGCCATAAGGAATTTCCTCGAGGAAATTCCTTATGGCGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129851.1-1878s21c1
Sequence:CCGGCCCACATCGCCTGGCTAATTTCTCGAGAAATTAGCCAGGCGATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129851.1-812s21c1
Sequence:CCGGAGTCAGCGTGAAGCAGTTATTCTCGAGAATAACTGCTTCACGCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001129851
LOC100132832 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129851.1-1067s21c1
Sequence:CCGGTTCTAGATGATCTGCACAAATCTCGAGATTTGTGCAGATCATCTAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129851.1-1019s21c1
Sequence:CCGGGGACAACGTGATCACTGTATTCTCGAGAATACAGTGATCACGTTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129851.1-844s21c1
Sequence:CCGGCTGTGCGCCATAAGGAATTTCCTCGAGGAAATTCCTTATGGCGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129851.1-1878s21c1
Sequence:CCGGCCCACATCGCCTGGCTAATTTCTCGAGAAATTAGCCAGGCGATGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129851.1-812s21c1
Sequence:CCGGAGTCAGCGTGAAGCAGTTATTCTCGAGAATAACTGCTTCACGCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)