EMAIL THIS PAGE TO A FRIEND

LOC100499484-C9ORF174

42 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301159 ANTI-KIAA1529 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020893 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020893 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020893 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020893 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035577 predicted 5046
2 SASI_Hs01_00035579 predicted 4039
3 SASI_Hs01_00035580 predicted 2244
4 SASI_Hs02_00354211 predicted 1302
5 SASI_Hs01_00035581 predicted 4213
6 SASI_Hs01_00035582 predicted 1188
7 SASI_Hs01_00035583 predicted 1013
8 SASI_Hs01_00035584 predicted 1126
9 SASI_Hs01_00035585 predicted 4015
10 SASI_Hs02_00354212 predicted 4918
11 SASI_Hs01_00035576 predicted 2197
12 SASI_Hs01_00035578 predicted 1298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020893
LOC100499484-C9ORF174 MISSION shRNA Bacterial Glycerol Stock
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020893.1-5057s1c1
Sequence:CCGGCCAGGCAAATAAGTACCACAACTCGAGTTGTGGTACTTATTTGCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020893.1-6119s1c1
Sequence:CCGGCCAGGAATCAGTCACTTCAAACTCGAGTTTGAAGTGACTGATTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020893.1-5357s1c1
Sequence:CCGGCAGCATGATTAGGATGAACAACTCGAGTTGTTCATCCTAATCATGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020893.1-1315s1c1
Sequence:CCGGGCCTAAATCAATCGGCAGAGTCTCGAGACTCTGCCGATTGATTTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020893.1-4944s1c1
Sequence:CCGGGCAGAGGAGTTCTACCGTAAACTCGAGTTTACGGTAGAACTCCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020893.1-4290s1c1
Sequence:CCGGCAACAGCTTCAGAACAAGATACTCGAGTATCTTGTTCTGAAGCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020893.1-2714s1c1
Sequence:CCGGGCATGTGCAGAATTGTAAGAACTCGAGTTCTTACAATTCTGCACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020893
LOC100499484-C9ORF174 MISSION shRNA shRNA Plasmid DNA
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020893.1-5057s1c1
Sequence:CCGGCCAGGCAAATAAGTACCACAACTCGAGTTGTGGTACTTATTTGCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020893.1-6119s1c1
Sequence:CCGGCCAGGAATCAGTCACTTCAAACTCGAGTTTGAAGTGACTGATTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020893.1-5357s1c1
Sequence:CCGGCAGCATGATTAGGATGAACAACTCGAGTTGTTCATCCTAATCATGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020893.1-1315s1c1
Sequence:CCGGGCCTAAATCAATCGGCAGAGTCTCGAGACTCTGCCGATTGATTTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020893.1-4944s1c1
Sequence:CCGGGCAGAGGAGTTCTACCGTAAACTCGAGTTTACGGTAGAACTCCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020893.1-4290s1c1
Sequence:CCGGCAACAGCTTCAGAACAAGATACTCGAGTATCTTGTTCTGAAGCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020893.1-2714s1c1
Sequence:CCGGGCATGTGCAGAATTGTAAGAACTCGAGTTCTTACAATTCTGCACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020893
LOC100499484-C9ORF174 MISSION shRNA Lentiviral Transduction Particles
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020893.1-5057s1c1
Sequence:CCGGCCAGGCAAATAAGTACCACAACTCGAGTTGTGGTACTTATTTGCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020893.1-6119s1c1
Sequence:CCGGCCAGGAATCAGTCACTTCAAACTCGAGTTTGAAGTGACTGATTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020893.1-5357s1c1
Sequence:CCGGCAGCATGATTAGGATGAACAACTCGAGTTGTTCATCCTAATCATGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020893.1-1315s1c1
Sequence:CCGGGCCTAAATCAATCGGCAGAGTCTCGAGACTCTGCCGATTGATTTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020893.1-4944s1c1
Sequence:CCGGGCAGAGGAGTTCTACCGTAAACTCGAGTTTACGGTAGAACTCCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020893.1-4290s1c1
Sequence:CCGGCAACAGCTTCAGAACAAGATACTCGAGTATCTTGTTCTGAAGCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020893.1-2714s1c1
Sequence:CCGGGCATGTGCAGAATTGTAAGAACTCGAGTTCTTACAATTCTGCACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)