EMAIL THIS PAGE TO A FRIEND

LOC124685

17 Gene Product Result for
Species: Human LOC124685(124685)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_064265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_064265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_064265 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_064265 Rosetta Predictions human pricing
XR_040247 Rosetta Predictions human pricing
XR_040249 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_064265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257425 predicted 222
2 SASI_Hs01_00257426 predicted 231
3 SASI_Hs01_00257427 predicted 229
4 SASI_Hs01_00257428 predicted 256
5 SASI_Hs01_00257429 predicted 139
6 SASI_Hs01_00257430 predicted 399
7 SASI_Hs01_00257431 predicted 307
8 SASI_Hs01_00257432 predicted 308
9 SASI_Hs01_00257433 predicted 256
10 SASI_Hs01_00257434 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517189 predicted 54
2 SASI_Hs02_00517190 predicted 92
3 SASI_Hs02_00517191 predicted 35
4 SASI_Hs02_00517192 predicted 24
5 SASI_Hs02_00517193 predicted 69
6 SASI_Hs02_00517194 predicted 122
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517195 predicted 30
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_064265
LOC124685 MISSION shRNA Bacterial Glycerol Stock
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000203555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064265.1-286s1c1
Sequence:CCGGGTGTTTGACAAGGAAGGAAATCTCGAGATTTCCTTCCTTGTCAAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064265.1-270s1c1
Sequence:CCGGCGTAGAAGGACTTCAGGTGTTCTCGAGAACACCTGAAGTCCTTCTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064265.1-201s1c1
Sequence:CCGGCTTTGAGCACTTTCTGCCCATCTCGAGATGGGCAGAAAGTGCTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_064265
LOC124685 MISSION shRNA shRNA Plasmid DNA
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000203555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064265.1-286s1c1
Sequence:CCGGGTGTTTGACAAGGAAGGAAATCTCGAGATTTCCTTCCTTGTCAAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064265.1-270s1c1
Sequence:CCGGCGTAGAAGGACTTCAGGTGTTCTCGAGAACACCTGAAGTCCTTCTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064265.1-201s1c1
Sequence:CCGGCTTTGAGCACTTTCTGCCCATCTCGAGATGGGCAGAAAGTGCTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_064265
LOC124685 MISSION shRNA Lentiviral Transduction Particles
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000203555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064265.1-286s1c1
Sequence:CCGGGTGTTTGACAAGGAAGGAAATCTCGAGATTTCCTTCCTTGTCAAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064265.1-270s1c1
Sequence:CCGGCGTAGAAGGACTTCAGGTGTTCTCGAGAACACCTGAAGTCCTTCTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064265.1-201s1c1
Sequence:CCGGCTTTGAGCACTTTCTGCCCATCTCGAGATGGGCAGAAAGTGCTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)