EMAIL THIS PAGE TO A FRIEND

LOC128322

29 Gene Product Result for
Species: Human LOC128322(128322)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_060943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_060943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_060943 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001716411 Rosetta Predictions human pricing
XM_060943 Rosetta Predictions human pricing
XM_938802 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00410363 predicted 234
2 SASI_Hs02_00410364 predicted 733
3 SASI_Hs02_00410365 predicted 652
4 SASI_Hs02_00410366 predicted 313
5 SASI_Hs02_00410367 predicted 538
6 SASI_Hs02_00410368 predicted 311
7 SASI_Hs02_00410369 predicted 732
8 SASI_Hs02_00410370 predicted 237
9 SASI_Hs02_00410371 predicted 754
10 SASI_Hs02_00410372 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_060943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478714 predicted 2
2 SASI_Hs02_00478715 predicted 87
3 SASI_Hs02_00478716 predicted 85
4 SASI_Hs02_00478717 predicted 229
5 SASI_Hs02_00478718 predicted 106
6 SASI_Hs02_00478719 predicted 312
7 SASI_Hs02_00478720 predicted 116
8 SASI_Hs02_00478721 predicted 11
9 SASI_Hs02_00478722 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_938802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483294 predicted 88
2 SASI_Hs02_00483295 predicted 10
3 SASI_Hs02_00483296 predicted 82
4 SASI_Hs02_00483297 predicted 111
5 SASI_Hs02_00483298 predicted 232
6 SASI_Hs02_00483299 predicted 317
7 SASI_Hs02_00483300 predicted 10
8 SASI_Hs02_00483301 predicted 347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_060943
LOC128322 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000188940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060943.1-157s1c1
Sequence:CCGGGTGGAGAAGTTGTCTAGCCTTCTCGAGAAGGCTAGACAACTTCTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060943.1-42s1c1
Sequence:CCGGCAATCAACATTACTACCAGTTCTCGAGAACTGGTAGTAATGTTGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060943.1-54s1c1
Sequence:CCGGCTACCAGTTATTTGATAACGACTCGAGTCGTTATCAAATAACTGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060943.1-162s1c1
Sequence:CCGGGAAGTTGTCTAGCCTTCCCTTCTCGAGAAGGGAAGGCTAGACAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_060943
LOC128322 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000188940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060943.1-157s1c1
Sequence:CCGGGTGGAGAAGTTGTCTAGCCTTCTCGAGAAGGCTAGACAACTTCTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060943.1-42s1c1
Sequence:CCGGCAATCAACATTACTACCAGTTCTCGAGAACTGGTAGTAATGTTGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060943.1-54s1c1
Sequence:CCGGCTACCAGTTATTTGATAACGACTCGAGTCGTTATCAAATAACTGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060943.1-162s1c1
Sequence:CCGGGAAGTTGTCTAGCCTTCCCTTCTCGAGAAGGGAAGGCTAGACAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_060943
LOC128322 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000188940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060943.1-157s1c1
Sequence:CCGGGTGGAGAAGTTGTCTAGCCTTCTCGAGAAGGCTAGACAACTTCTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060943.1-42s1c1
Sequence:CCGGCAATCAACATTACTACCAGTTCTCGAGAACTGGTAGTAATGTTGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060943.1-54s1c1
Sequence:CCGGCTACCAGTTATTTGATAACGACTCGAGTCGTTATCAAATAACTGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060943.1-162s1c1
Sequence:CCGGGAAGTTGTCTAGCCTTCCCTTCTCGAGAAGGGAAGGCTAGACAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)