EMAIL THIS PAGE TO A FRIEND

LOC129026

Gene Product Result for
Species: Human LOC129026(129026)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080842
LOC129026 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080842.1-139s1c1
Sequence:CCGGCGGATATTGGACAGAGGACATCTCGAGATGTCCTCTGTCCAATATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080842.1-169s1c1
Sequence:CCGGCGACACCCACTTAAACTCGAACTCGAGTTCGAGTTTAAGTGGGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080842.1-175s1c1
Sequence:CCGGCCACTTAAACTCGAAGTTGCACTCGAGTGCAACTTCGAGTTTAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080842.1-163s1c1
Sequence:CCGGGAGATGCGACACCCACTTAAACTCGAGTTTAAGTGGGTGTCGCATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080842.1-186s1c1
Sequence:CCGGCGAAGTTGCAAAGATGCAAATCTCGAGATTTGCATCTTTGCAACTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080842
LOC129026 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080842.1-139s1c1
Sequence:CCGGCGGATATTGGACAGAGGACATCTCGAGATGTCCTCTGTCCAATATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080842.1-169s1c1
Sequence:CCGGCGACACCCACTTAAACTCGAACTCGAGTTCGAGTTTAAGTGGGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080842.1-175s1c1
Sequence:CCGGCCACTTAAACTCGAAGTTGCACTCGAGTGCAACTTCGAGTTTAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080842.1-163s1c1
Sequence:CCGGGAGATGCGACACCCACTTAAACTCGAGTTTAAGTGGGTGTCGCATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080842.1-186s1c1
Sequence:CCGGCGAAGTTGCAAAGATGCAAATCTCGAGATTTGCATCTTTGCAACTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080842
LOC129026 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080842.1-139s1c1
Sequence:CCGGCGGATATTGGACAGAGGACATCTCGAGATGTCCTCTGTCCAATATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080842.1-169s1c1
Sequence:CCGGCGACACCCACTTAAACTCGAACTCGAGTTCGAGTTTAAGTGGGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080842.1-175s1c1
Sequence:CCGGCCACTTAAACTCGAAGTTGCACTCGAGTGCAACTTCGAGTTTAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080842.1-163s1c1
Sequence:CCGGGAGATGCGACACCCACTTAAACTCGAGTTTAAGTGGGTGTCGCATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080842.1-186s1c1
Sequence:CCGGCGAAGTTGCAAAGATGCAAATCTCGAGATTTGCATCTTTGCAACTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)