EMAIL THIS PAGE TO A FRIEND

LOC143188

51 Gene Product Result for
Species: Human LOC143188(143188)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025447 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025447 Rosetta Predictions human pricing
XR_017700 Rosetta Predictions human pricing
XR_017867 Rosetta Predictions human pricing
XR_041028 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190846 predicted 307
2 SASI_Hs01_00190847 predicted 456
3 SASI_Hs01_00190848 predicted 458
4 SASI_Hs01_00190849 predicted 193
5 SASI_Hs01_00190850 predicted 134
6 SASI_Hs01_00190851 predicted 379
7 SASI_Hs01_00190852 predicted 205
8 SASI_Hs01_00190853 predicted 436
9 SASI_Hs01_00190854 predicted 255
10 SASI_Hs01_00190855 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494032 predicted 574
2 SASI_Hs02_00494033 predicted 300
3 SASI_Hs02_00494034 predicted 315
4 SASI_Hs02_00494035 predicted 254
5 SASI_Hs02_00494036 predicted 493
6 SASI_Hs02_00494037 predicted 330
7 SASI_Hs02_00494038 predicted 558
8 SASI_Hs02_00494039 predicted 557
9 SASI_Hs02_00494040 predicted 373
10 SASI_Hs02_00494041 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494790 predicted 576
2 SASI_Hs02_00494791 predicted 299
3 SASI_Hs02_00494792 predicted 314
4 SASI_Hs02_00494793 predicted 261
5 SASI_Hs02_00494794 predicted 498
6 SASI_Hs02_00494795 predicted 325
7 SASI_Hs02_00494796 predicted 560
8 SASI_Hs02_00494797 predicted 556
9 SASI_Hs02_00494798 predicted 370
10 SASI_Hs02_00494799 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00524046 predicted 569
2 SASI_Hs02_00524047 predicted 304
3 SASI_Hs02_00524048 predicted 313
4 SASI_Hs02_00524049 predicted 493
5 SASI_Hs02_00524050 predicted 385
6 SASI_Hs02_00524051 predicted 491
7 SASI_Hs02_00524052 predicted 557
8 SASI_Hs02_00524053 predicted 560
9 SASI_Hs02_00524054 predicted 301
10 SASI_Hs02_00524055 predicted 312
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025447
LOC143188 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025447.1-126s1c1
Sequence:CCGGGCACCATGAAAGGCATTACCACTCGAGTGGTAATGCCTTTCATGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025447.1-385s1c1
Sequence:CCGGGTCAGTAACCACAGGATTCTTCTCGAGAAGAATCCTGTGGTTACTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025447.1-116s1c1
Sequence:CCGGCTGCATGGAAGCACCATGAAACTCGAGTTTCATGGTGCTTCCATGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025447.1-210s1c1
Sequence:CCGGCGATAAGAAGGAGATTCACTACTCGAGTAGTGAATCTCCTTCTTATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025447.1-209s1c1
Sequence:CCGGGCGATAAGAAGGAGATTCACTCTCGAGAGTGAATCTCCTTCTTATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025447.1-182s1c1
Sequence:CCGGCCAGTATGTAGGGAGAGCAATCTCGAGATTGCTCTCCCTACATACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025447
LOC143188 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025447.1-126s1c1
Sequence:CCGGGCACCATGAAAGGCATTACCACTCGAGTGGTAATGCCTTTCATGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025447.1-385s1c1
Sequence:CCGGGTCAGTAACCACAGGATTCTTCTCGAGAAGAATCCTGTGGTTACTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025447.1-116s1c1
Sequence:CCGGCTGCATGGAAGCACCATGAAACTCGAGTTTCATGGTGCTTCCATGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025447.1-210s1c1
Sequence:CCGGCGATAAGAAGGAGATTCACTACTCGAGTAGTGAATCTCCTTCTTATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025447.1-209s1c1
Sequence:CCGGGCGATAAGAAGGAGATTCACTCTCGAGAGTGAATCTCCTTCTTATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025447.1-182s1c1
Sequence:CCGGCCAGTATGTAGGGAGAGCAATCTCGAGATTGCTCTCCCTACATACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025447
LOC143188 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025447.1-126s1c1
Sequence:CCGGGCACCATGAAAGGCATTACCACTCGAGTGGTAATGCCTTTCATGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025447.1-385s1c1
Sequence:CCGGGTCAGTAACCACAGGATTCTTCTCGAGAAGAATCCTGTGGTTACTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025447.1-116s1c1
Sequence:CCGGCTGCATGGAAGCACCATGAAACTCGAGTTTCATGGTGCTTCCATGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025447.1-210s1c1
Sequence:CCGGCGATAAGAAGGAGATTCACTACTCGAGTAGTGAATCTCCTTCTTATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025447.1-209s1c1
Sequence:CCGGGCGATAAGAAGGAGATTCACTCTCGAGAGTGAATCTCCTTCTTATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025447.1-182s1c1
Sequence:CCGGCCAGTATGTAGGGAGAGCAATCTCGAGATTGCTCTCCCTACATACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)