EMAIL THIS PAGE TO A FRIEND

LOC145757

40 Gene Product Result for
Species: Human LOC145757(145757)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037224 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037224 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037224 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037224 Rosetta Predictions human pricing
XR_040806 Rosetta Predictions human pricing
XR_040807 Rosetta Predictions human pricing
XR_040808 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236201 predicted 224
2 SASI_Hs01_00236202 predicted 323
3 SASI_Hs01_00236203 predicted 337
4 SASI_Hs01_00236204 predicted 266
5 SASI_Hs01_00236205 predicted 198
6 SASI_Hs01_00236206 predicted 362
7 SASI_Hs01_00236207 predicted 209
8 SASI_Hs01_00236208 predicted 326
9 SASI_Hs01_00236209 predicted 257
10 SASI_Hs01_00236210 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522091 predicted 238
2 SASI_Hs02_00522092 predicted 316
3 SASI_Hs02_00522093 predicted 371
4 SASI_Hs02_00522094 predicted 242
5 SASI_Hs02_00522095 predicted 287
6 SASI_Hs02_00522096 predicted 238
7 SASI_Hs02_00522097 predicted 244
8 SASI_Hs02_00522098 predicted 315
9 SASI_Hs02_00522099 predicted 318
10 SASI_Hs02_00522100 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522101 predicted 560
2 SASI_Hs02_00522102 predicted 579
3 SASI_Hs02_00522103 predicted 637
4 SASI_Hs02_00522104 predicted 504
5 SASI_Hs02_00522105 predicted 558
6 SASI_Hs02_00522106 predicted 509
7 SASI_Hs02_00522107 predicted 580
8 SASI_Hs02_00522108 predicted 582
9 SASI_Hs02_00522109 predicted 550
10 SASI_Hs02_00522110 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522111 predicted 238
2 SASI_Hs02_00522112 predicted 313
3 SASI_Hs02_00522113 predicted 372
4 SASI_Hs02_00522114 predicted 235
5 SASI_Hs02_00522115 predicted 286
6 SASI_Hs02_00522116 predicted 242
7 SASI_Hs02_00522117 predicted 246
8 SASI_Hs02_00522118 predicted 310
9 SASI_Hs02_00522119 predicted 317
10 SASI_Hs02_00522120 predicted 284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037224
LOC145757 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000180808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037224.1-257s1c1
Sequence:CCGGGAAGTCGTTTCTGTCCACAGTCTCGAGACTGTGGACAGAAACGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037224.1-260s1c1
Sequence:CCGGGTCGTTTCTGTCCACAGTCATCTCGAGATGACTGTGGACAGAAACGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037224.1-123s1c1
Sequence:CCGGGAAGACACAATGCCTCCTATTCTCGAGAATAGGAGGCATTGTGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037224.1-136s1c1
Sequence:CCGGCTCCTATTGTCTCTGCCACTTCTCGAGAAGTGGCAGAGACAATAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037224
LOC145757 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000180808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037224.1-257s1c1
Sequence:CCGGGAAGTCGTTTCTGTCCACAGTCTCGAGACTGTGGACAGAAACGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037224.1-260s1c1
Sequence:CCGGGTCGTTTCTGTCCACAGTCATCTCGAGATGACTGTGGACAGAAACGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037224.1-123s1c1
Sequence:CCGGGAAGACACAATGCCTCCTATTCTCGAGAATAGGAGGCATTGTGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037224.1-136s1c1
Sequence:CCGGCTCCTATTGTCTCTGCCACTTCTCGAGAAGTGGCAGAGACAATAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037224
LOC145757 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000180808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037224.1-257s1c1
Sequence:CCGGGAAGTCGTTTCTGTCCACAGTCTCGAGACTGTGGACAGAAACGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037224.1-260s1c1
Sequence:CCGGGTCGTTTCTGTCCACAGTCATCTCGAGATGACTGTGGACAGAAACGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037224.1-123s1c1
Sequence:CCGGGAAGACACAATGCCTCCTATTCTCGAGAATAGGAGGCATTGTGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037224.1-136s1c1
Sequence:CCGGCTCCTATTGTCTCTGCCACTTCTCGAGAAGTGGCAGAGACAATAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)