EMAIL THIS PAGE TO A FRIEND

LOC149134

42 Gene Product Result for
Species: Human LOC149134(149134)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207326 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_378945 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_378945 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_378945 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207326 Rosetta Predictions human pricing
XR_040996 Rosetta Predictions human pricing
XR_040997 Rosetta Predictions human pricing
XR_040998 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039565 predicted 1391
2 SASI_Hs01_00039566 predicted 1580
3 SASI_Hs01_00039567 predicted 1671
4 SASI_Hs01_00039568 predicted 1176
5 SASI_Hs01_00039569 predicted 1506
6 SASI_Hs01_00039570 predicted 1681
7 SASI_Hs01_00039571 predicted 1348
8 SASI_Hs01_00039572 predicted 1170
9 SASI_Hs01_00039573 predicted 1679
10 SASI_Hs01_00039574 predicted 1846
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523754 predicted 223
2 SASI_Hs02_00523755 predicted 705
3 SASI_Hs02_00523756 predicted 518
4 SASI_Hs02_00523757 predicted 250
5 SASI_Hs02_00523758 predicted 312
6 SASI_Hs02_00523759 predicted 503
7 SASI_Hs02_00523760 predicted 662
8 SASI_Hs02_00523761 predicted 494
9 SASI_Hs02_00523762 predicted 305
10 SASI_Hs02_00523763 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523764 predicted 231
2 SASI_Hs02_00523765 predicted 701
3 SASI_Hs02_00523766 predicted 521
4 SASI_Hs02_00523767 predicted 251
5 SASI_Hs02_00523768 predicted 315
6 SASI_Hs02_00523769 predicted 501
7 SASI_Hs02_00523770 predicted 669
8 SASI_Hs02_00523771 predicted 493
9 SASI_Hs02_00523772 predicted 308
10 SASI_Hs02_00523773 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00523774 predicted 227
2 SASI_Hs02_00523775 predicted 701
3 SASI_Hs02_00523776 predicted 517
4 SASI_Hs02_00523777 predicted 253
5 SASI_Hs02_00523778 predicted 496
6 SASI_Hs02_00523779 predicted 661
7 SASI_Hs02_00523780 predicted 495
8 SASI_Hs02_00523781 predicted 303
9 SASI_Hs02_00523782 predicted 233
10 SASI_Hs02_00523783 predicted 332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207326
LOC149134 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207326.1-1182s1c1
Sequence:CCGGCTTCATTAACAGAACGAACACCTCGAGGTGTTCGTTCTGTTAATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207326.1-2185s1c1
Sequence:CCGGCAGAATCTAGAAACCAGCTTTCTCGAGAAAGCTGGTTTCTAGATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207326.1-1172s1c1
Sequence:CCGGCAGGCAAGGGCTTCATTAACACTCGAGTGTTAATGAAGCCCTTGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207326.1-1181s1c1
Sequence:CCGGGCTTCATTAACAGAACGAACACTCGAGTGTTCGTTCTGTTAATGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207326.1-2142s1c1
Sequence:CCGGCCTGGCCTGCTCTACTTATATCTCGAGATATAAGTAGAGCAGGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207326.1-1295s1c1
Sequence:CCGGCAGCAAGCAAGCTTCAGAAGACTCGAGTCTTCTGAAGCTTGCTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207326
LOC149134 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207326.1-1182s1c1
Sequence:CCGGCTTCATTAACAGAACGAACACCTCGAGGTGTTCGTTCTGTTAATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207326.1-2185s1c1
Sequence:CCGGCAGAATCTAGAAACCAGCTTTCTCGAGAAAGCTGGTTTCTAGATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207326.1-1172s1c1
Sequence:CCGGCAGGCAAGGGCTTCATTAACACTCGAGTGTTAATGAAGCCCTTGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207326.1-1181s1c1
Sequence:CCGGGCTTCATTAACAGAACGAACACTCGAGTGTTCGTTCTGTTAATGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207326.1-2142s1c1
Sequence:CCGGCCTGGCCTGCTCTACTTATATCTCGAGATATAAGTAGAGCAGGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207326.1-1295s1c1
Sequence:CCGGCAGCAAGCAAGCTTCAGAAGACTCGAGTCTTCTGAAGCTTGCTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207326
LOC149134 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207326.1-1182s1c1
Sequence:CCGGCTTCATTAACAGAACGAACACCTCGAGGTGTTCGTTCTGTTAATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207326.1-2185s1c1
Sequence:CCGGCAGAATCTAGAAACCAGCTTTCTCGAGAAAGCTGGTTTCTAGATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207326.1-1172s1c1
Sequence:CCGGCAGGCAAGGGCTTCATTAACACTCGAGTGTTAATGAAGCCCTTGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207326.1-1181s1c1
Sequence:CCGGGCTTCATTAACAGAACGAACACTCGAGTGTTCGTTCTGTTAATGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207326.1-2142s1c1
Sequence:CCGGCCTGGCCTGCTCTACTTATATCTCGAGATATAAGTAGAGCAGGCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207326.1-1295s1c1
Sequence:CCGGCAGCAAGCAAGCTTCAGAAGACTCGAGTCTTCTGAAGCTTGCTTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_378945
LOC149134 MISSION shRNA Bacterial Glycerol Stock
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000122055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378945.1-537s1c1
Sequence:CCGGCTGGAAGAAGTCGTAATCGAACTCGAGTTCGATTACGACTTCTTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378945.1-403s1c1
Sequence:CCGGGATGTTCTTAAGGAAAGCAGACTCGAGTCTGCTTTCCTTAAGAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_378945
LOC149134 MISSION shRNA shRNA Plasmid DNA
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000122055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378945.1-537s1c1
Sequence:CCGGCTGGAAGAAGTCGTAATCGAACTCGAGTTCGATTACGACTTCTTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378945.1-403s1c1
Sequence:CCGGGATGTTCTTAAGGAAAGCAGACTCGAGTCTGCTTTCCTTAAGAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_378945
LOC149134 MISSION shRNA Lentiviral Transduction Particles
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000122055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378945.1-537s1c1
Sequence:CCGGCTGGAAGAAGTCGTAATCGAACTCGAGTTCGATTACGACTTCTTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378945.1-403s1c1
Sequence:CCGGGATGTTCTTAAGGAAAGCAGACTCGAGTCTGCTTTCCTTAAGAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)