EMAIL THIS PAGE TO A FRIEND

LOC149950

42 Gene Product Result for
Species: Human LOC149950(149950)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010976 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010976 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010976 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010976 Rosetta Predictions human pricing
XR_040847 Rosetta Predictions human pricing
XR_040848 Rosetta Predictions human pricing
XR_040849 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019982 predicted 314
2 SASI_Hs01_00019983 predicted 317
3 SASI_Hs01_00019984 predicted 321
4 SASI_Hs01_00019985 predicted 295
5 SASI_Hs01_00019986 predicted 388
6 SASI_Hs01_00019987 predicted 379
7 SASI_Hs01_00019988 predicted 328
8 SASI_Hs01_00019989 predicted 378
9 SASI_Hs01_00019990 predicted 389
10 SASI_Hs01_00019991 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522477 predicted 8
2 SASI_Hs02_00522478 predicted 166
3 SASI_Hs02_00522479 predicted 169
4 SASI_Hs02_00522480 predicted 111
5 SASI_Hs02_00522481 predicted 9
6 SASI_Hs02_00522482 predicted 165
7 SASI_Hs02_00522483 predicted 173
8 SASI_Hs02_00522484 predicted 166
9 SASI_Hs02_00522485 predicted 108
10 SASI_Hs02_00522486 predicted 174
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522487 predicted 7
2 SASI_Hs02_00522488 predicted 167
3 SASI_Hs02_00522489 predicted 173
4 SASI_Hs02_00522490 predicted 113
5 SASI_Hs02_00522491 predicted 9
6 SASI_Hs02_00522492 predicted 167
7 SASI_Hs02_00522493 predicted 176
8 SASI_Hs02_00522494 predicted 167
9 SASI_Hs02_00522495 predicted 106
10 SASI_Hs02_00522496 predicted 171
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522497 predicted 11
2 SASI_Hs02_00522498 predicted 174
3 SASI_Hs02_00522499 predicted 170
4 SASI_Hs02_00522500 predicted 114
5 SASI_Hs02_00522501 predicted 5
6 SASI_Hs02_00522502 predicted 165
7 SASI_Hs02_00522503 predicted 177
8 SASI_Hs02_00522504 predicted 171
9 SASI_Hs02_00522505 predicted 109
10 SASI_Hs02_00522506 predicted 177
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010976
LOC149950 MISSION shRNA Bacterial Glycerol Stock
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010976.1-480s1c1
Sequence:CCGGCAAGAAGACATGCTTTGCCCTCTCGAGAGGGCAAAGCATGTCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010976.1-424s1c1
Sequence:CCGGCAGCAGTGACAACTGTGTTATCTCGAGATAACACAGTTGTCACTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010976.1-426s1c1
Sequence:CCGGGCAGTGACAACTGTGTTATGACTCGAGTCATAACACAGTTGTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010976.1-677s1c1
Sequence:CCGGCTCCCTGCTTTCTTTGTCTGTCTCGAGACAGACAAAGAAAGCAGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010976.1-436s1c1
Sequence:CCGGCTGTGTTATGAAGCACCTACTCTCGAGAGTAGGTGCTTCATAACACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010976.1-681s1c1
Sequence:CCGGCTGCTTTCTTTGTCTGTCTCACTCGAGTGAGACAGACAAAGAAAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010976.1-469s1c1
Sequence:CCGGCAAGAATGGAACAAGAAGACACTCGAGTGTCTTCTTGTTCCATTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010976
LOC149950 MISSION shRNA shRNA Plasmid DNA
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010976.1-480s1c1
Sequence:CCGGCAAGAAGACATGCTTTGCCCTCTCGAGAGGGCAAAGCATGTCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010976.1-424s1c1
Sequence:CCGGCAGCAGTGACAACTGTGTTATCTCGAGATAACACAGTTGTCACTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010976.1-426s1c1
Sequence:CCGGGCAGTGACAACTGTGTTATGACTCGAGTCATAACACAGTTGTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010976.1-677s1c1
Sequence:CCGGCTCCCTGCTTTCTTTGTCTGTCTCGAGACAGACAAAGAAAGCAGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010976.1-436s1c1
Sequence:CCGGCTGTGTTATGAAGCACCTACTCTCGAGAGTAGGTGCTTCATAACACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010976.1-681s1c1
Sequence:CCGGCTGCTTTCTTTGTCTGTCTCACTCGAGTGAGACAGACAAAGAAAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010976.1-469s1c1
Sequence:CCGGCAAGAATGGAACAAGAAGACACTCGAGTGTCTTCTTGTTCCATTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010976
LOC149950 MISSION shRNA Lentiviral Transduction Particles
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010976.1-480s1c1
Sequence:CCGGCAAGAAGACATGCTTTGCCCTCTCGAGAGGGCAAAGCATGTCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010976.1-424s1c1
Sequence:CCGGCAGCAGTGACAACTGTGTTATCTCGAGATAACACAGTTGTCACTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010976.1-426s1c1
Sequence:CCGGGCAGTGACAACTGTGTTATGACTCGAGTCATAACACAGTTGTCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165746    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010976.1-677s1c1
Sequence:CCGGCTCCCTGCTTTCTTTGTCTGTCTCGAGACAGACAAAGAAAGCAGGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010976.1-436s1c1
Sequence:CCGGCTGTGTTATGAAGCACCTACTCTCGAGAGTAGGTGCTTCATAACACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163325    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010976.1-681s1c1
Sequence:CCGGCTGCTTTCTTTGTCTGTCTCACTCGAGTGAGACAGACAAAGAAAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010976.1-469s1c1
Sequence:CCGGCAAGAATGGAACAAGAAGACACTCGAGTGTCTTCTTGTTCCATTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)