EMAIL THIS PAGE TO A FRIEND

LOC151009

5 Gene Product Result for
Species: Human LOC151009(151009)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152518 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152518 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152518 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_041916 Rosetta Predictions human pricing
XR_041917 Rosetta Predictions human pricing
XR_041918 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531492 predicted 194
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531493 predicted 194
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531494 predicted 200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152518
LOC151009 MISSION shRNA Bacterial Glycerol Stock
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152518.1-1669s1c1
Sequence:CCGGCCACTGAGTCTGTAGCTGTTTCTCGAGAAACAGCTACAGACTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152518.1-338s1c1
Sequence:CCGGCACTCCAGAAGAAACTACCTACTCGAGTAGGTAGTTTCTTCTGGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152518.1-1143s1c1
Sequence:CCGGCCTGGGTCTCAATTTCTTTATCTCGAGATAAAGAAATTGAGACCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152518.1-258s1c1
Sequence:CCGGCTATTTCAAGTGTACCATGCACTCGAGTGCATGGTACACTTGAAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152518.1-1009s1c1
Sequence:CCGGCCACACTTGCTAGATTGCTATCTCGAGATAGCAATCTAGCAAGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152518.1-343s1c1
Sequence:CCGGCAGAAGAAACTACCTACCCATCTCGAGATGGGTAGGTAGTTTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152518.1-77s1c1
Sequence:CCGGGTGAGAAGTTCTGCAGATGTACTCGAGTACATCTGCAGAACTTCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152518.1-300s1c1
Sequence:CCGGGAGTTGTGTATCCATCACCATCTCGAGATGGTGATGGATACACAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152518.1-348s1c1
Sequence:CCGGGAAACTACCTACCCATCAGCACTCGAGTGCTGATGGGTAGGTAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152518.1-76s1c1
Sequence:CCGGCGTGAGAAGTTCTGCAGATGTCTCGAGACATCTGCAGAACTTCTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152518
LOC151009 MISSION shRNA shRNA Plasmid DNA
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152518.1-1669s1c1
Sequence:CCGGCCACTGAGTCTGTAGCTGTTTCTCGAGAAACAGCTACAGACTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152518.1-338s1c1
Sequence:CCGGCACTCCAGAAGAAACTACCTACTCGAGTAGGTAGTTTCTTCTGGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152518.1-1143s1c1
Sequence:CCGGCCTGGGTCTCAATTTCTTTATCTCGAGATAAAGAAATTGAGACCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152518.1-258s1c1
Sequence:CCGGCTATTTCAAGTGTACCATGCACTCGAGTGCATGGTACACTTGAAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152518.1-1009s1c1
Sequence:CCGGCCACACTTGCTAGATTGCTATCTCGAGATAGCAATCTAGCAAGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152518.1-343s1c1
Sequence:CCGGCAGAAGAAACTACCTACCCATCTCGAGATGGGTAGGTAGTTTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152518.1-77s1c1
Sequence:CCGGGTGAGAAGTTCTGCAGATGTACTCGAGTACATCTGCAGAACTTCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152518.1-300s1c1
Sequence:CCGGGAGTTGTGTATCCATCACCATCTCGAGATGGTGATGGATACACAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152518.1-348s1c1
Sequence:CCGGGAAACTACCTACCCATCAGCACTCGAGTGCTGATGGGTAGGTAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152518.1-76s1c1
Sequence:CCGGCGTGAGAAGTTCTGCAGATGTCTCGAGACATCTGCAGAACTTCTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152518
LOC151009 MISSION shRNA Lentiviral Transduction Particles
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138511    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152518.1-1669s1c1
Sequence:CCGGCCACTGAGTCTGTAGCTGTTTCTCGAGAAACAGCTACAGACTCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152518.1-338s1c1
Sequence:CCGGCACTCCAGAAGAAACTACCTACTCGAGTAGGTAGTTTCTTCTGGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152518.1-1143s1c1
Sequence:CCGGCCTGGGTCTCAATTTCTTTATCTCGAGATAAAGAAATTGAGACCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152518.1-258s1c1
Sequence:CCGGCTATTTCAAGTGTACCATGCACTCGAGTGCATGGTACACTTGAAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152518.1-1009s1c1
Sequence:CCGGCCACACTTGCTAGATTGCTATCTCGAGATAGCAATCTAGCAAGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152518.1-343s1c1
Sequence:CCGGCAGAAGAAACTACCTACCCATCTCGAGATGGGTAGGTAGTTTCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152518.1-77s1c1
Sequence:CCGGGTGAGAAGTTCTGCAGATGTACTCGAGTACATCTGCAGAACTTCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152518.1-300s1c1
Sequence:CCGGGAGTTGTGTATCCATCACCATCTCGAGATGGTGATGGATACACAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152518.1-348s1c1
Sequence:CCGGGAAACTACCTACCCATCAGCACTCGAGTGCTGATGGGTAGGTAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152518.1-76s1c1
Sequence:CCGGCGTGAGAAGTTCTGCAGATGTCTCGAGACATCTGCAGAACTTCTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)