EMAIL THIS PAGE TO A FRIEND

LOC151121

30 Gene Product Result for
Species: Human LOC151121(151121)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001033657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001033657 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033657 Rosetta Predictions human pricing
XR_017948 Rosetta Predictions human pricing
XR_041796 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132779 predicted 200
2 SASI_Hs01_00132780 predicted 286
3 SASI_Hs01_00132781 predicted 275
4 SASI_Hs01_00132782 predicted 431
5 SASI_Hs01_00132783 predicted 206
6 SASI_Hs01_00132784 predicted 277
7 SASI_Hs01_00132785 predicted 179
8 SASI_Hs01_00132786 predicted 428
9 SASI_Hs01_00132787 predicted 272
10 SASI_Hs01_00132788 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495017 predicted 186
2 SASI_Hs02_00495018 predicted 354
3 SASI_Hs02_00495019 predicted 384
4 SASI_Hs02_00495020 predicted 357
5 SASI_Hs02_00495021 predicted 436
6 SASI_Hs02_00495022 predicted 429
7 SASI_Hs02_00495023 predicted 178
8 SASI_Hs02_00495024 predicted 354
9 SASI_Hs02_00495025 predicted 332
10 SASI_Hs02_00495026 predicted 112
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041796 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530407 predicted 181
2 SASI_Hs02_00530408 predicted 359
3 SASI_Hs02_00530409 predicted 392
4 SASI_Hs02_00530410 predicted 359
5 SASI_Hs02_00530411 predicted 432
6 SASI_Hs02_00530412 predicted 431
7 SASI_Hs02_00530413 predicted 179
8 SASI_Hs02_00530414 predicted 361
9 SASI_Hs02_00530415 predicted 333
10 SASI_Hs02_00530416 predicted 104
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033657
LOC151121 MISSION shRNA Bacterial Glycerol Stock
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000179885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033657.1-286s1c1
Sequence:CCGGCTTCATGATGTGTGTCTTCCACTCGAGTGGAAGACACACATCATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033657
LOC151121 MISSION shRNA shRNA Plasmid DNA
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000179885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033657.1-286s1c1
Sequence:CCGGCTTCATGATGTGTGTCTTCCACTCGAGTGGAAGACACACATCATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033657
LOC151121 MISSION shRNA Lentiviral Transduction Particles
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000179885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033657.1-286s1c1
Sequence:CCGGCTTCATGATGTGTGTCTTCCACTCGAGTGGAAGACACACATCATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)