EMAIL THIS PAGE TO A FRIEND

LOC153684

32 Gene Product Result for
Species: Human LOC153684(153684)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194290 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_018004 Rosetta Predictions human pricing
XR_040067 Rosetta Predictions human pricing
XR_040068 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_018004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495254 predicted 343
2 SASI_Hs02_00495255 predicted 1327
3 SASI_Hs02_00495256 predicted 1659
4 SASI_Hs02_00495257 predicted 1083
5 SASI_Hs02_00495258 predicted 321
6 SASI_Hs02_00495259 predicted 1488
7 SASI_Hs02_00495260 predicted 1296
8 SASI_Hs02_00495261 predicted 1492
9 SASI_Hs02_00495262 predicted 1646
10 SASI_Hs02_00495263 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515623 predicted 343
2 SASI_Hs02_00515624 predicted 1334
3 SASI_Hs02_00515625 predicted 1656
4 SASI_Hs02_00515626 predicted 1085
5 SASI_Hs02_00515627 predicted 313
6 SASI_Hs02_00515628 predicted 1487
7 SASI_Hs02_00515629 predicted 1293
8 SASI_Hs02_00515630 predicted 1492
9 SASI_Hs02_00515631 predicted 1638
10 SASI_Hs02_00515632 predicted 1208
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515633 predicted 348
2 SASI_Hs02_00515634 predicted 1335
3 SASI_Hs02_00515635 predicted 1654
4 SASI_Hs02_00515636 predicted 1086
5 SASI_Hs02_00515637 predicted 321
6 SASI_Hs02_00515638 predicted 1488
7 SASI_Hs02_00515639 predicted 1295
8 SASI_Hs02_00515640 predicted 1495
9 SASI_Hs02_00515641 predicted 1640
10 SASI_Hs02_00515642 predicted 1212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194290
LOC153684 MISSION shRNA Bacterial Glycerol Stock
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194290.1-350s1c1
Sequence:CCGGGAAACCGTCGACTCTGAGAAACTCGAGTTTCTCAGAGTCGACGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194290.1-1972s1c1
Sequence:CCGGGCTATAAACTCCTTCCTCATACTCGAGTATGAGGAAGGAGTTTATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194290.1-550s1c1
Sequence:CCGGCACGACTAGCAGTTGACACAACTCGAGTTGTGTCAACTGCTAGTCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194290.1-796s1c1
Sequence:CCGGGCTGGGCTAGACTAGAAACTTCTCGAGAAGTTTCTAGTCTAGCCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194290.1-1546s1c1
Sequence:CCGGGCTTGCCTTTGAAACTTGAAACTCGAGTTTCAAGTTTCAAAGGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194290.1-552s1c1
Sequence:CCGGCGACTAGCAGTTGACACAAACCTCGAGGTTTGTGTCAACTGCTAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194290.1-709s1c1
Sequence:CCGGCGTAGGGATACCACAGAGAAACTCGAGTTTCTCTGTGGTATCCCTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194290.1-1682s1c1
Sequence:CCGGGCTCGTTGATTCTGATGGTTACTCGAGTAACCATCAGAATCAACGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194290.1-300s1c1
Sequence:CCGGGTTGTCAAGGACAACATTTGTCTCGAGACAAATGTTGTCCTTGACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194290.1-1715s1c1
Sequence:CCGGCCTTGATATTGGACATAGGATCTCGAGATCCTATGTCCAATATCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194290
LOC153684 MISSION shRNA shRNA Plasmid DNA
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194290.1-350s1c1
Sequence:CCGGGAAACCGTCGACTCTGAGAAACTCGAGTTTCTCAGAGTCGACGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194290.1-1972s1c1
Sequence:CCGGGCTATAAACTCCTTCCTCATACTCGAGTATGAGGAAGGAGTTTATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194290.1-550s1c1
Sequence:CCGGCACGACTAGCAGTTGACACAACTCGAGTTGTGTCAACTGCTAGTCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194290.1-796s1c1
Sequence:CCGGGCTGGGCTAGACTAGAAACTTCTCGAGAAGTTTCTAGTCTAGCCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194290.1-1546s1c1
Sequence:CCGGGCTTGCCTTTGAAACTTGAAACTCGAGTTTCAAGTTTCAAAGGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194290.1-552s1c1
Sequence:CCGGCGACTAGCAGTTGACACAAACCTCGAGGTTTGTGTCAACTGCTAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194290.1-709s1c1
Sequence:CCGGCGTAGGGATACCACAGAGAAACTCGAGTTTCTCTGTGGTATCCCTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194290.1-1682s1c1
Sequence:CCGGGCTCGTTGATTCTGATGGTTACTCGAGTAACCATCAGAATCAACGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194290.1-300s1c1
Sequence:CCGGGTTGTCAAGGACAACATTTGTCTCGAGACAAATGTTGTCCTTGACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194290.1-1715s1c1
Sequence:CCGGCCTTGATATTGGACATAGGATCTCGAGATCCTATGTCCAATATCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194290
LOC153684 MISSION shRNA Lentiviral Transduction Particles
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194290.1-350s1c1
Sequence:CCGGGAAACCGTCGACTCTGAGAAACTCGAGTTTCTCAGAGTCGACGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194290.1-1972s1c1
Sequence:CCGGGCTATAAACTCCTTCCTCATACTCGAGTATGAGGAAGGAGTTTATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194290.1-550s1c1
Sequence:CCGGCACGACTAGCAGTTGACACAACTCGAGTTGTGTCAACTGCTAGTCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194290.1-796s1c1
Sequence:CCGGGCTGGGCTAGACTAGAAACTTCTCGAGAAGTTTCTAGTCTAGCCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194290.1-1546s1c1
Sequence:CCGGGCTTGCCTTTGAAACTTGAAACTCGAGTTTCAAGTTTCAAAGGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194290.1-552s1c1
Sequence:CCGGCGACTAGCAGTTGACACAAACCTCGAGGTTTGTGTCAACTGCTAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194290.1-709s1c1
Sequence:CCGGCGTAGGGATACCACAGAGAAACTCGAGTTTCTCTGTGGTATCCCTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194290.1-1682s1c1
Sequence:CCGGGCTCGTTGATTCTGATGGTTACTCGAGTAACCATCAGAATCAACGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194290.1-300s1c1
Sequence:CCGGGTTGTCAAGGACAACATTTGTCTCGAGACAAATGTTGTCCTTGACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194290.1-1715s1c1
Sequence:CCGGCCTTGATATTGGACATAGGATCTCGAGATCCTATGTCCAATATCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)