EMAIL THIS PAGE TO A FRIEND

LOC154872

52 Gene Product Result for
Species: Human LOC154872(154872)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024603 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024603 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024603 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024603 Rosetta Predictions human pricing
XR_041807 Rosetta Predictions human pricing
XR_041808 Rosetta Predictions human pricing
XR_041809 Rosetta Predictions human pricing
XR_041810 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211186 predicted 236
2 SASI_Hs01_00211187 predicted 532
3 SASI_Hs01_00211188 predicted 416
4 SASI_Hs01_00211189 predicted 515
5 SASI_Hs01_00211190 predicted 578
6 SASI_Hs01_00211191 predicted 258
7 SASI_Hs01_00211192 predicted 615
8 SASI_Hs01_00211193 predicted 193
9 SASI_Hs01_00211194 predicted 288
10 SASI_Hs01_00211195 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530517 predicted 536
2 SASI_Hs02_00530518 predicted 93
3 SASI_Hs02_00530519 predicted 535
4 SASI_Hs02_00530520 predicted 581
5 SASI_Hs02_00530521 predicted 418
6 SASI_Hs02_00530522 predicted 137
7 SASI_Hs02_00530523 predicted 133
8 SASI_Hs02_00530524 predicted 166
9 SASI_Hs02_00530525 predicted 17
10 SASI_Hs02_00530526 predicted 97
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530527 predicted 535
2 SASI_Hs02_00530528 predicted 97
3 SASI_Hs02_00530529 predicted 541
4 SASI_Hs02_00530530 predicted 580
5 SASI_Hs02_00530531 predicted 415
6 SASI_Hs02_00530532 predicted 129
7 SASI_Hs02_00530533 predicted 134
8 SASI_Hs02_00530534 predicted 174
9 SASI_Hs02_00530535 predicted 19
10 SASI_Hs02_00530536 predicted 106
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530537 predicted 531
2 SASI_Hs02_00530538 predicted 91
3 SASI_Hs02_00530539 predicted 534
4 SASI_Hs02_00530540 predicted 578
5 SASI_Hs02_00530541 predicted 419
6 SASI_Hs02_00530542 predicted 130
7 SASI_Hs02_00530543 predicted 132
8 SASI_Hs02_00530544 predicted 174
9 SASI_Hs02_00530545 predicted 18
10 SASI_Hs02_00530546 predicted 97
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00530547 predicted 532
2 SASI_Hs02_00530548 predicted 97
3 SASI_Hs02_00530549 predicted 539
4 SASI_Hs02_00530550 predicted 582
5 SASI_Hs02_00530551 predicted 421
6 SASI_Hs02_00530552 predicted 137
7 SASI_Hs02_00530553 predicted 128
8 SASI_Hs02_00530554 predicted 171
9 SASI_Hs02_00530555 predicted 23
10 SASI_Hs02_00530556 predicted 98
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024603
LOC154872 MISSION shRNA Bacterial Glycerol Stock
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000167808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024603.1-269s1c1
Sequence:CCGGGCAATATTGGAATCAAAGGATCTCGAGATCCTTTGATTCCAATATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024603.1-217s1c1
Sequence:CCGGCCTGAAATCACGCAGGATGAACTCGAGTTCATCCTGCGTGATTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024603
LOC154872 MISSION shRNA shRNA Plasmid DNA
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000167808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024603.1-269s1c1
Sequence:CCGGGCAATATTGGAATCAAAGGATCTCGAGATCCTTTGATTCCAATATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024603.1-217s1c1
Sequence:CCGGCCTGAAATCACGCAGGATGAACTCGAGTTCATCCTGCGTGATTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024603
LOC154872 MISSION shRNA Lentiviral Transduction Particles
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000167808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024603.1-269s1c1
Sequence:CCGGGCAATATTGGAATCAAAGGATCTCGAGATCCTTTGATTCCAATATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024603.1-217s1c1
Sequence:CCGGCCTGAAATCACGCAGGATGAACTCGAGTTCATCCTGCGTGATTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)